Description :
From Genome Similarity Track
Location :
scaffold_66:40192- 41283
Sequence
1091 bases(100 bases per row)
TAGAAAAAGATAAATACAgccaatttttttgtgcaaTCGCCTTTTCCCAGAAAGGATGTGCTGCCGAACAGCTTGCTTTGCTGCACTATGTAGAGTGCAT
TCTTTCTTGTCACTGAAAGCTATTACTGCCAACTGAGTCAGTAGTCTCCCGCTGATTGTAATTGAACCTGTCTGGCGCAAAAAGTCGTGATAACATCGAG
TCTTCTGGCAGGATATAAACTGAAGCTGTCTGGGCTCGTCGCTTAGACAGTTTCGTGCATCAGCGACGTTTGATTGTCTTTgtattttgaaaatgatttA
TCCATAGTTGTGAAGTGCCCAGGAAGTCGGATGTAGGAATCCATATTGATCACTTCCAAGCTATGCTTAAGTATATACGCTTAAATATGCTATCAGTCAA
CATAGACAAATGTGTCCTTGTCGCTGAACTAAAACTTTATTTGTTGGGAGCTTTATCGAGAGAAATGATTTTTTGAAGATACGGTCGGTCACCTCTAAGC
CAAATTGCTGCGCACAAATGTGATGAGTTGCAGCCTCAAGTGTCACTATCTCTATTGTTGGATGTTGACATAAGTGAgatctactggctacccactTACA
CGAAACTCAGTGCAAAATATTACGACACGGAGCGTTCACTcatcaatcttgccaaaacgGATGTTTAATGATATTGGGGTGCGGTAAATAATACGGTTTG
TATAGCCGTAGAAATAAATTTATCGTGCCAATATTTTGAATCCGACTCAGCCATTTCATGTCGTCTGCGTCAGTACGGCTACATCCATAGGTTGTCTCTT
ACTTAAAGCAGCTTTTAATTAGTGTATCATCAGGATTGAGCTTTGCCATCATTTATGCAGCAGATTAAAATTTCCCAGCGTTTGACAAGGAGCCACTGGC
GTTAAAGTATGCTCTGGTCAAGCTCCGAATTTTCTTGCTTGGATATAAGTCACTTGTGATCACTACAGATCATGAACAATTGCGCACATCGACATCGTTT
TTACCTTCTTGCTACCAGAGATTCGCTAGTTGGCTATCCGCTTTTCCGTGTATACCTCCCTGGAAAGTAACAATCGCGCTGGCTCAATGTG