Description :
From Genome Similarity Track
Location :
contig_24:401909- 403461
Transcript NameFunction/comments
g4596.t1hypothetical protein

Sequence
1552 bases(100 bases per row)
CTGATTGCAGTACCGGACGCAAAAGCAACGATGCAGTGAAAACTCGACTGAATTGGTTGTTTCTTCGATGCAAGTTTCCTATCCCCAAGAACTGCGAATT
CAAATAGAGTTAATCGCACGAGAAATACTGAATGCCAGTGCATGTCGGACCAGTTGTCGCTTGCGTAGCTGGTCAGGCTCCGGCATGTACCTGCGTGGAA
ACTGAAGGACACGCAGAATCCCCTCCATGTCACTCTGCAAAAGTTGCTCCTTCAGTTCATCGAGGATTACAAGCGAAACGCTGAACATGATTCGCCACCC
ATCAATAACAAAGATATCCAGCAGGCGGGTCACCAGCGTCGGTGCTAACGTCTCGAACGATGAAAAGAACGTCAAGAACCATCTTGTGCAGAAGGTAGCA
ACATGCACACCCTCAGCTTGGAGATGTGTGTATAGCTCTGGCATGTGCGTCGAAAACAAAAGCTCGAACTTCGACAGATACGGCTGCAGCACGGCCATTC
CCGGCTCATAGAGATTGCGGTCATTCTCCGGCTCAGAGAACCCCACGAACAGCCAGAAAATATCTGCTTCATCGTTAGCGACTTCAGCCAGCAAGCGCAC
TAAAAAGCCCATCCCTTGGCAATAGCCCACACGAGGGTTATAAAGGACGTATGCACGGAGTACGCGACGAATCTTCGCTTCCAGTTCTGAGTTTTCCGTG
CTGTCGAAACTCGATTCACTGCCTTCATTTCTGACAATGCAGTCAATCAACTCCATCATGACGGACTCAACCGAGTCTTTATCATTGCTCATCTCAGTAC
TTGATATTGGTGGAGATAGACTCGAAACCGTTTCCACATTGCCGTCATGTATGCTTCGGTGGCAAGTTCGCACGACATCAACGTCAATTTCCCGGAACCA
AACTGCAAGCTGGGAATCGTCATCACTCAGAGGCAACCCTTCTGCAATTAGCCCGTCCGCTAACTTTACCTCCACTTTCGTCAGAAGCTGATCATACATG
CTGTGGCGCCTGTCTGGAGAAAGGTAGTGGGATGCAATTCCACTTGAGCGCCATGGCGTTGACTCATAGAACACTGAGAGCCAAAGTGAGCTGCGAATGG
CTGGAGATAGTCCGCCCGACCGGATGCACTTTTTCCAAATAGGGGCGCTATCAGTAGATGGGAACGCAGCCGAAAGTTGACCTGAATGTGTTGGGATCGC
CATGATCAGTTTAAAGAAAGAAGCGGAAAGCAAATAGATACTCACCTTGGACAGTCGCGCAAGGTCTTCGACACGAAGGTACGACAGGCATTCGAAGTAC
AGCGCATCGTGCTACAAAGCCACAAGCATGTTGTGAGAGGATTACACATTATACACAAGCTAGCAGGCCTATGCTAATCAAACCTTTTGAAGTAATCCAG
AAAGAAGAACATCTGCGGTGGAGCTGATTGAATCTGCCGTCAGTAGCGATTTCCCGGGTGATTTAGCCTCCCTCAAATCAATTTCCCACAAACATTCTTC
GATGGCTAGCCATTCTGTAGCAGACTGCGGAATGATATGAAGCTGCTCGCCA