Description :
From Genome Similarity Track
Location :
Scaffold_38:401873- 407782
Transcript NameFunction/comments
Phyra_79293multiple inositol polyphosphate phosphatase, putative
Phyra_79294multiple inositol polyphosphate phosphatase, putative
Phyra_79295RxLR effector candidate precursor, partial

Sequence
5909 bases(100 bases per row)
GTTTTTAAACCTACGCTTTGGCACTTTCACCCGTGCGCGCCTTGAACGTGTGTGTAAGCAAGAACTGGCTTGGGTTATACACCGTCGGGAATGCCGAGCC
CACCGACTTTCGGGTGCGTTTCCCATACGCTGCAAGCTCATCAAACCCAGTCGAAGATAGGGTCCCTGCAACTGTAAGGTTATACGGGAGCGAATAGTCC
TTCAACCACTGCGGGATGACACTCGAATAATTCGCCTGAAGCCTTTCCAACAGATCGGCAATCTCTACCATGGTATTGTCGGTAGGAAACCTAAAACAGG
AGATACAGCGCTTAGCGTCAAAAAGAGGCATGACTCAGTATTTTCCCCTTACCTGCTTCCATGACGACTCACCTGCTGAATCTGAAGCAGCTCCAGATCT
GATGCCTGGATTCCTGTCGACCTTGCATTCGACTGCACAAGGTTTGAAGAAGTACTACGCTGATCCCAATACATCGTCATCGTTCCAAACGAACGAGGGC
TAATTGCACTGGAGTTAGCAGCCTTCAGGCTGTCAAGCTCAACGACGACAGCATTCTTGTCTTCGTAGCCACCTGTGGCTACTAGCAGGATTGTTGCAAG
GACACCTGTGGCAGCCAGGAATCGGCCGATCGTTACCACCGGCAAGGCCGGCGATGAACCTGGAGATTTTTCTCGGTCGAACGCTTCGAAGTTCCTCGTC
ATTGGTTCTTGGCACTCCCTTCGCGACAAATACAAACTGCGGTGGTCTCTTTCGCATGATGGTCGCCATGCGCTCTTATCGGTCGTTTCATTTGCAAACA
ATTTTAGAGAGCAGACAAATCTGTCCAAAGCAACTTGGACAATGAGAATGCTACCTCGTTTCAATCGGAAGTATCTTGTGCGGGCACTCGAACCTGATCT
ATCATGACGTCGATCTTGATCGTTCTACACGGCACAGTCCGCCTCGAAGTCGTAGTCGTTGATATAGTAGCTCCAAATCTCTTCCACTTTTGAAAGCTCG
CAGTACATTGCGCCATCGCATCCGGGCAAAGGAGCTTCCACCTCCTGAATCCACACCGATACGTAGTACTTCTGGTCCGCCTTGCTACGATACAGACGAA
AATCGATGTTCGAGGCTGTGGGAGCTAGAGCCGACGAGCGGAAGCCACGCGAGTCAATTTGCTCTTCTGTCCACGACGCCAAAAGCTTAGTGCGGTCGCC
GTAGCCCAACAGTGTCATGAGCGGAAGTGTGGTTTCGGCATGGGCGAAACGAAGGTTACCCACAATCGTCGTGTCACCTGTGGTGAAATTCTTCATGTAG
GCGTAAATGTCCTGTAGCAGCACAGCCGACATTTCGTAGTTGATCTTGTATCCGGCACCCTGCTCGTAAAAGGTTTCCAGCTCGTCCGAGTACTCCAGGT
GATTCAGAAATATTTGATTGACAAGGGAGCACCACTGATCAGTGACGTTGCTCAGCATAATGTCAAATCTGTATCACAATTCAAAACGACATTAGGACAT
TCTCAAGCAACTCCTTTCGTAGCAATGCAGGACGCACGCGCAGGCGGAGAACGCGGACGCAGCATCTGTGGTACTGATGTCAGCGTCACTGGGCAGGTTC
AGCTGAGACTTGAGAGACACGATGCTTTCGTTCATCTTTCCTGAGATTTGGAATGCGTCAAACGCCTGGAGCGCGCTGGAGTTGTCTGCGATTTCTGCGA
CATAACGAGCACACTCATCGAAGAAGCGAAGCAGTGGGTCCTGAAAGCGTATCAAGAAGTTTGGAAATGGAATCAGTTGACACAAAGAACTGTTCCCCAA
AGCTGGGAAGTACTGCACGCCTTACGCTGCCGTCCGGGTACTCCGTGTACTCCACATCCTCCGGGTTGCTGAAGAACGTACTGGCAAACCTTTAGTGTCA
CCAGCAAGTTGTAAAGTCAGTTCTGAGGCAATGAACAATCTACAAAAGAGCACGTACGATTGAGCACTCTCGCCGGTGCGCGTGACACTAGTGTGCGCTA
GCTTGAACAAGCTGGCATTGTACGCCGTCGGGATGGCCGAACCAACGGAGTTCCGAGAGCGCGAACCGTACCCCACGAGTTCCGCAAAGCCCGCGGGTGC
AAGCTCGCCCGCGTCTGTCGAGTTGTACGGCAGCGAGTAGTTTTTAAGCCACTCCGGAATGAAGTTTGAGTAGTTCGCCTGCAACTTGTCCAGCAGGTCG
GTGATCTCTCCCATGTTCCCTTTGGTGGGGTATCTGCTTCCGTGGCGACTCACTTGTTGCAGCTGCACCAGCTCCAGATCTTCCGCTTGGACGCTTGCAT
TCGCCTGCAACACCGAGATAAGGGCGGAGTCGCGTTGATCCCAGTACTTGGTCTTGGTGGCAAACGACTGTAAGCTGAAGCTGCTACCAGCGTCCGCACT
AGGCGACGCGGTGAGGAGGACGAGAAGAATCGCCAACTTGTCGAGCATGGCACCCTGTGTGTCACGGTGAGTATCTACCGTGGGGTAAATCTGAAAGTGA
GCTGCATGTGTCCCCGGTCGAGGTCATTAGAGTCTAATTTAGACAGACTGAGGGTCAGGATGCAATGCATCCACTGCACTTTCCTTCGTCACGTGACCAC
CCAACGTTGGATGGCCTTCCAACAGCTGCCTTCATGAGTTGCACGGAAGCTGAGCAGACCATGACCACTTGCGCAGACAGCGCGGGAGTTTTTGGTCTTC
TATCAGGTGTCATGTTGATACAAGCACGCGACCGCCACCAGATTCGCTCGTGAATCTCTACCAGATGCAGACGTTGAAGTTGCTGTCTATAGAAGTTTGC
TTTGTCAAATCAAGGGTATGTGCGAATTTTTGAGTTGTGTGCTCAACATTAATGTGATGTACAGTACATTTATTTGTCCGAGATCCGGCTGGCCATTCAA
GAAAGCCTTCGGCGGGTGGGAGCATGGGGGGCCACGAGCACCGCGAGGGCCACGGCCGCTCGCGCGCGGGCGCGTGGGAAGGTTTCGAGAAGCTCAAGCA
GGCGCTGGAGGGCCTGGCCACGGCCAAGGGGGTGTCCCAGAGCCGCATCGGCGCCGTGGCCAAGCTGGCGGCGCATTATTCCAAGGTGAAGAGGCGATGC
ATTTAGTTTTTATTATTTGGAGGCTGTCTGCTGACTTGGAATTTGTATGCGACAGTTCTACAAACACGTGGTGCACGACATCGAAGTCTTTCTATGGAAG
GCGGAGGTGGAGCACCGATTGGCTGGTACGAGTTTATATTTTCTTAGTGGGGGGAGGGAGGAATTCTCAGTTTGTTCTTGTTTGTGTGTGTTTTCATTAT
TATTTAGGACTCTACGCTATTGATGCCATTATCCGACAGGTACGTTATAATATTTTATTATATTTGCTGACAGTTGCTGAGAGGATTTATTGTTTTTTTC
CTGCAGGCTCATGCCAAAAACGGCCCGAAAGACGTGTACGTCAAACGTTTCCTGATTCGGCTGGCGGACACCATTGCAGCAGTGAAGAAGGTCCCGGAGG
AGTCCCAGGTAAGAGAGGAAAATGCTGTTGGTATGTGAAGCAGATTTCTGATCTTTTGATTGTGTAGTTGAAGGTTCGGCACGTGATTGAAGAATGGCAA
AAGCGCGGGGTTTACTCAACGAAACAGATTGAAGACGCTGGGGGACGTGAATATCTGTTCAAGGGACAAGTAAGCAATTTTTTTTTATGTGGTGTTGAGA
TTCCTATGGTTCTAACATGCTGCTTTATTTGTTGTCGTTTAGGAGGAGCAGTCGGAAAATGTTACGCCACGTGCATCGCCAGGAAAGTTGGCTTCGCTGT
TATCCATTATCAAACAGAAGAAAGGCGAGCAGGAGCACCCAGGCGACCAACAGTCCCGGCCACCTTTTAACGACTCGTACACCAGAGACCAACGGCAAGG
AGACAAGGGTGGGGCGTATAACCAGCGAAGCTACGACGAACGACGAACGAATGATCAGCGCTACGAGAGCAGTGACACCGGCGGCATTATGGGCGATGCG
CCTGGTGTGCCCGTCGGAAGTGGTCGCATTCGGAGAACCCCTGATGACCACCCAAGCGACATGGACGACCGTGATCCGAAAAAAGCTCGTGGCTCCCGGT
GGGGGCCATCTAGGTCGGACAACAACTCATCAAACGATAGGCCTGCTCCAATTGTTACGTCCCTGGACAGAGAGGGAGATTATCGACCTGATAGTGGCAA
AAATGGTTACGGTTCACCACCGGGGTCATCTCGTCAGGCCCCGCCAAGACATGAAGAGTGGAACAGAAATGCACCTCCCATTCGTGGTTCTGGCGCCGGA
TGGCCTCGTAGTGAAGGCGTGCGATCACCACAGTCTGGAAGTCTAGGTAGACAGAACGCGAGCCCGTATGAGCAGGGCGGTATGCAGCGATCCCCGTTCT
CTGGATCGGACGACCGGCGTAGTCCAGGTAACCGCGTGCCAGGGACCTCTGGAGAAGTTTGCCGCAACTTCTTGGCTGGCAGATGCACGTTTGGTGATCG
TTGCTGGTACGGTGGGTTGTTCAACCAGCTTTTGTTTTGCGCCTATATTTTTCATGCGAAAGAACACTAACTTTGCTTCATTTGATTTTGCTATAGGCAC
ATTCACGACCAGCAGGCCCTTCAGTCAGGAGGCCGTTCAGAAATGGCTGAAGTTAGGCGCAAAACTGTGCTGTGCAATAATTTCCCGCTCGGGAAGTGCC
GCTTTGGGGATAACTGCAGGTACTACTCGATTAGTAGCATTGACGTTTGCTTTGTCTGCGAGGTCGCAACTAGGTTGCCTTGCCTCTTTCCCTTAATGGA
CCGTTCTCTGATGATGGACTCCCTTTGTGGGCCCTGTTTTTTTTTGCCGTTTACGTGGATCTCTCTTTCAGCTTTGCTCACGGAGAAGATGAACTTGACA
AGTCCGCGAGACGACCTCCCGTGCATGGTGAACCAACTGGAAGCCGCTGGCAACCATCGCCGAGCGCACTGCCAAGTGCGGAGCAGTCACGCATTTTGCC
TTCTCCCAGTGCGTCTGCTCCACCTCCCCAAGCTAGATCTTACGGAGCCCCGCAAGCTGTATATAATGAACCACACGGTGATCGCGGCACTAGAGAAGGT
GATTCTTCCGTATCTTATGCTAACGCCGCTGCGCCCTCGCCCGGTGGGCGCCGGCCGCCACCCGACCACCAGTCTGCCCCCACGGCGCCTCCACAAGGCT
ACCCAGGGTCGTTCACCTCGGCCTCGTCTCCGTACGGCACCACTGCTGGATCAACGTTTATGAACCAAGCTCCGACTTACCCGAGTGGTGGCGACCAAGG
TCGAAGCCGCATCCCAGGCGGTGCACCCGTGCTATCATCCCCTGGCTCGCTGTCGCAGTCTTACGGGGGCGTTGTTGCTGCTTCTGCTCCGGGCCCGAGT
CCCAAGGTCCTTGCAGACGACGACGATGGCGACACCGTTGAACCCGAGTTTACTCTGGAGTACGATGACGACGACTAAATGGAGATAAGTGGCGTTTGTC
AAACACATTGAGGTTCATTAGGCGCGACAAGACGCTCATGCACTTGTACATGTTATCGCCGAGACGTTCAGCAGACGAGGTACCAGGACAAGTCAAGAGG
AGTGATAGCAAGAACCAGGTCGGCTGATGCACTTTTGAGTATAGCGAACACGATTCTCAACTCATTAAACAGGAAATTATTTCGTGTCCACAGATGTCCA
CCATTGAGGTGGACACTTCTCATGTACCCATTCTATTTTCATCCAATCATACGTTGTTATCCTTCAATTTTGTGCCCCCATTGGCTAATTTGAATCGCAA
AATCTTCTGATAACAGCAAGCATGAGAAGCCCCCCAGGTGCATCGGGGTCACCTCCCCCTCCCTTTCCCTACGTGCCTCGTCGACTGCTACATGCACTCG
CAATCGCTT