Description :
From Genome Similarity Track
Location :
Scaffold_66:40180- 43515
Transcript NameFunction/comments
Hyaar_Emoy2807587hypothetical protein

Sequence
3335 bases(100 bases per row)
GAGACATTGAATGTCTTGGTTAATGACGGCTCAAGTGTAGGCGCTTGTACACTTGATCTGATCGCGCCTCCGAAGTTGACTTCGGAGATCACTCAATTGC
CAACGCTGGAACGGAAACGGTTCTTGCGAGATCTGCGTAGTGGCAAGATCAAGCAGATTTGTGTACTCGTCACGAAGGATGAGTACGTGACTGACATTCG
GTCGGCAGTATTATTTGCAGAGAACGAACAGGTTCTCAGCGGTTCATCAATGAACGAAAGTGTCCTTGATGAGAAGACTCGGATTGAGAGATACACGTCT
CGATCTGCGGAGTCGCTTCAGGCAAATCATTTATATAACGATTTGATCGAATTCAAGGACGTGTTCCATGAATCCGGACCATGCGAATTGCCTAAGGATA
AAGGCACTCGACATGAAATCGAGCTTAAAGTGGGCTCGAAGTATTGTGTCATGAAGCAGTGGCAACTGCCTCGTGAACAAGTACTTGCGATCGATAAGTT
CTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGGAGTCAACTTTCCCTCACAGCTTTCCGACCTTCTGTGTGCGCAAGGCCACGGGAGGATGGCGGATA
GTGCACACATTCTACAAGTTGAAATCTGCAACGTTACCAGCTCAGACGCCGATACCGAGGAAGGACGTAATCATTGATGGTATGTCAAAGCGTACCACCT
TTACGTCCATGGATCATATGGATCGCTTCTATGATATCCTATTGCGTGAACGGGACATCCCGTACACGGCAGTAAGCACCCCGAGCGGTATGCTCTGGCA
GTGTCTAGTAATGCCACAAGGGCTTAGCAACGCCCCTGCCACATTCAACAGATGTGCTATAAATCGGTTGAGACCGGTGCGAGATTTCGCACTGAGTTAC
TTCGACGATGCACGGGCGGAAAGACGGACGTAGAGGTTCATAGAACTCACGTTTGTCAGATTATTACACTTATGCGCAAGCATAAGCTGTACGACAACCT
CAAGAAGTGTATATTTGCTGCTAGCAAAATACCACTTCTCGGGTGCATCGTGAGTAAACACGGCGTACGCCCTGATCCTGAAAAGATCAAGGCGATTACC
GACTGGCCTGTGCCAGTAGACGTTATGGGACTAAGAAAGTTCCTCGATCTAGCGTCGTAATTACACAAGTACTCGCGCAACTACGCTGAAATGACCGTTC
ATCTCTCTCGTCTCTTGAAAAAGAACGATAATTGGTCATGGAACGCTGATTATTAGCGTTCCTTTGAAAGTATCAAGCAGAGCTTGATTCAATCGCCCAT
CTTGGCGATTGAAGACCAAGACAGACCATTCCATGTGGTCTGTGAAGCCAGCGATTTCGCAATCGGCGGCGCGTTAATTCAGTACGATGCAGACGGAGCA
GAACGTGTCATCTGTTATCAATCGCGTCGGCTGCAAGCAGATTAGCGTAATTATCCGGTGCATGACAAGAAACTCCTTGCCATGAAGAATGCACTGGCGA
AGTTTCGCGTCTACCTCCTTGGATATAGGCCATTCATAGTCTGTACGGACCATGCGTCATTACGAACGGCCTTAAACAGCCCACACCTCTCGCAAATAAT
GGCGAGGTGGCTGTCCTTCTTTGAGTAGTACAACTCTCCGTAGAGTATAAACCCGGACGACTCAATGTCGTCGCGGACGCGTTGTCGCGCCGACCTGAAT
TCGAGTCGTCTGTGCAGTCCAACAATGAGGTTGATACCACTGTTGCAACACTAGTCACTAGTGTTCCGTCGTCAATATTGCTTGACGACATAAAAAAGGC
TTGCGCAGAAGATAAGGCTATTCTGCGACTAATGGATCATCTGGTGACTCCATCTCGTACATCTCTTAAAGATTTACTGGCCTTGTATCAATCTTCCGCG
GGTCGATACACAACACGCAACGGGTTTGATGTATTATACAGCCGCTGCTGGCGACACACCTCGTGTCGTCGTCCCCACTCATAATTATTTGCGCTTGCGC
ACCTTGCATGAGTGCCATGATGCACCACCTAGTGGGCATCGTGGGAGTGAGAAGAATTATCTCACGGTAAGTTGCGATTTTTACTGGCCCCCCCAGTATC
AGTTTGGGCGCAAGTACATCCGTGCTTGTGAAGTGTGCCAACGGGTGAAGTTTAGTCATTCCTCTACCAATCCTGGCAGAGTGCTGGTAGCCGTTTCAAT
GGACTTCGTCTTCGGTTTACCTGAAGACGCTCACAAGAATAATGGTATTCTTGTGTTCGTAGACCGATTCAGCAAGATGGTACATTTTGCTGCAGTTAAT
GAGTCAATCTCAGCACATGGTTGTGTCCGTGTCTTCATTGACACGGTATTCCGACTCCAGGGTCTTCATTGACACGGTATTCCGGCTCCAGGGTCTACCC
CGTGAACTAGTCTCTGATAGAGATCCTCGGTTCACGGCGACGTTTTGGCAATCCGTGTTCCGATCCCTCGGAACACGTCTGACTATGTCTACTTCTGATC
ACCCCGATACTGATTGTTAAACAGAACGCGTCAACCGCGTCCTCGAAGAGATCCTTCGAGGATACGTCCAATCTTTCACAGATTGGAGCAAAGTTTTGCC
GATGATGGAGCTTTTAATCAACAACTCCGTGCATGCATCGACAACGCATCCACCATTTTTCGTGAACGGCTTACGCCATCCACGCCTACCCACCCATTTA
GAGTGTGACACTAATTCAAGGGGGGGAGGGATTCGCTCGAGCAAAAACCGTTCTGGCTCTTGCTCATCACGTGTCGAGGTAATCGACGACGCGAACGTTG
CCGATGTTGATCAAATTAAAATCGAAGCTGATGATCTCAGCAATAGTGAAGACACTATTGCTGAGCCAGATAAGGATGGCGATGCTGGTATATTTAGCAT
CACCAATGACTACACCGTCGAGGATGATAATACCCTCGCTGAAAACGAGGATGTCCTCCTGGCGCTGCGCACAAGGCGAAATGCAACAAATCAAAGTGAG
TCAGCAGAAGATTTCCTGCTGGCACGAGAAGCAGTGATCCGTTTCGTGCAAAACTTCATCGCTAACGCGGTGAACCGGCAGAAACGGAACGCTGAAAAAC
ATGTAAAATCAAATGCTCTTCTATTTAATGTCGGAAACTTAGTTCTACTGTCTACGGTAAATTTACCTAAGCACGTAGTAACTAATGTGGGTAGTAGTAA
ACTACTACTCAAGTACATCGGCCTGTTCCGTGTACTACATCGAAAGGCAATGGGTACACAATCGATTTGCCTTACAGGATGCGTACGCATCCTACGTTGT
ATGTCGGTCGTCTCCGCTCGTACCATCAGCACAAG