Description :
From Genome Similarity Track
Location :
Scaffold_1329:4016- 5724
Transcript NameFunction/comments
Phyin_T30-4PITG_22103Triosephosphate isomerase/glyceraldehyde-3-phosphate dehydrogenase%2C putative

Sequence
1708 bases(100 bases per row)
TGACTGAAAGTGAGAGGCTGCAAACCATTCGATACGTGTAGTCTAGCGCAATTACAAGTGGCACGTTTTTACTGGCAGATAATTAACCAATAAGCAGTAG
TAGCTCTGATAACTTGCTGTCGTCAATTTTAATTTACCGGACAGATGCAAAATTATCCGGACGATCGTGGCGATTATGCCTCATTGTTAAATTTCCTAGC
TCATGCGCACATGACTCTCATGCAAAAAATGCATAGAAAAAAAATAGTGATTTTCTCAGCCCAGAGGGCGTTTCAGGCCATTTCCTGCCGTCTATAAAAC
AGTCTGTTTGACCACTCTGGCCTTTTGCGTCATTTCACATCACAGTAAAAAAAAAAAACACACTTCACGTGAGCATAGACAGACTTGGTGCTTGGGTTCT
TATCTCGACGTTTGTACTCCTTAGAAATCTCAAGTTCTCTACGGCCCCTGAACTAGCAATCCCTCGAAAGGATCCACCAGTGGTCTCTCATTCTTAGACC
TGCAAACACCAGCCAACCCCCTCCCATCTAGAGCGCAATGGTAAACGTGGCCATCAACGGTTTCGGTCGCATCGGCCGCCTCGTGCTTCGCGCCGCTGCC
AAGAACCCTAGTATCAAGGTCGTAGCCGTAAATGATCCCTTCATCGCCACCAAGTACATGGAATACATGCTGAAGTACGACACCGTGCACGGCCGCTTCG
ACGGTAAGATCGATCACGACGAGAAAAATATCTACGTGGACGGCAAGCCTATCCGTGTGTTCAACGAGATGAACCCCGAGAATATTAAGTGGGGCGAGGA
GCAGGTGCAATACGTGGTGGAGTCCACGAGTGCCTTCACGACACTGGAGAAGGCATCGACCCACTTGAAGAACGGCGTGGAGAAGGTGGTGATCTCGGCT
CCGTCCAGTGACGCCCCCATGTTCGTGATGGGCGTGAATCACGAGCTGTACGAGAAGAACATGCACGTGGTGTCGAACGCTTCGTGCACGACAAACTGCC
TGGCCCCTCTGGCTAAGGTGGTGAACAACAAGTTTGGCATCAAGGAAGGCCTCATGACGACTGTCCACGCTGTGACTGCCACGCAGAAGACAGTTGACGG
TCCTTCCAAGAAGGACTGGCGTGGTGGTCGTGGCGCTTGCTTCAACATCATCCCAAGCTCTACTGGTGCTGCTAAGGCTGTGGGAAAGGTGATCCCGAGC
CTGAACGGTAAGCTGACGGGCATGTCGTTCCGTGTGCCGACTGCTGATGTGTCTGTGGTGGACCTGACGGCTCGTCTGGTGAACCCTGCTTCGTACGACG
AGATTAAGGCTGCCATTAAGTCGGCCAGTGAGAACGAGATGAAGGGCATTCTCGGCTACACAGAGAAGGCTGTGGTGTCGAGCGACTTTATCGGCGACTC
GCACTCGTCGATCTTTGATGCCGAGGCCGGTATTGCCCTGACAGATGACTTCGTGAAGCTTGTGTCGTGGTATGACAATGAGTGGGGATACAGCTCGCGT
GTGCTGGACCTGATTGAGCACATGGTTAAGAACGAGTAAGCAAATCGAAGCGGCGTTACCATGCACTTGCAGCTGACATATAACGACAAAAATATGATTA
AAAGTAAGGCACCTTGGATTGCAGTAAATTTTACACGGTATCTCTCCCACGCACATGAAGCCCTTTGCGACTTCCATATCATAACGACTCCGACCAGCCG
AGCACCTT