Description :
From Genome Similarity Track
Location :
Scaffold_29:40159- 41175
Transcript NameFunction/comments
Physo_133937hypothetical protein

Sequence
1016 bases(100 bases per row)
ATTTCCGCTCTTGGAAACGACATGGGCAAGAGCAATCCGCCACAGTCCCCACTGCCGACCCCGCAGTCGCTGACGCCCGTCGTCACCGCCGGCTACAGCA
CCAAGCTATGGGATGCCAGGGCCCCCAAGTATTCCAAGAACGTCATGAGGAGCGTCTGCATCTTCCTCTGCGTCGTGACGTTCTGTGAAGAGCTCGCCGG
CTGCGGCGTCAACCAGTCGCTCAAGAACTTCTTCCAGAAGCTCGAGTGGTCCAACAAAGGCTCCAACTCCATGAAGCTCACGTACGACTCGCTCAGCCAG
TTCGCTTGTATCGCCGCGGCGTTCATCGCAGACCAGTACCTGGGAAAGTACAGGACGCTGCTTGGCGCGACCTCATTCAGCCCGCTCGGCTTCGTGCTGA
TCATGATCGCAGCCTTGCCGTCCGTCCTGGAGAACCAAATGTTGAACAAGGTGCTCTTCTGCGTCGGCCTCTTCCTGGGTATCGCACTGAATCAAGTTGG
CATGAGTTCGCTGTTGGTATCATTCGGCGGCGACCAGTTCTCCCCGGCGTCTCCTCCTGAGCAGCGAGCGTCGTACTTCAGCATCAACTACTGGTCATCA
AACTTGGGTGTCGCTATCAACTACGCGGTGTTTCCGTCGCTGTGTCTGAACGGCGTTGGAGCCATCCCCGCGGACTACGGATACGTCGCCGTCTTCGCTA
TCGGCTTGGCGCTAATGCTGTCAATCATCGCGAACTTGATTGCTACCCGCCGTCGCTACATCCACGTCCCTCCCACGAAGAGCGCGCTTGGAAGTGTGAT
CCATGTGGTGGTCTGTAGCTGCAAGCACAGCTTCAGTGCGAAAATGATTGTACTTGGCGCGATCCTGTACTTGGCCGCGTTGTTCCTCAACATCCTTGCG
GCATTCATGTCGGATGATGGCGAGACCGGCCATCGCATCTCATACGTCTGTGGCGCTCTCATCGTTGTAGCTACCGTCCTTTGGATCTACTTCGGACAAG
ATGTATCCATGGTCGG