Description :
From Genome Similarity Track
Location :
scaffold_160:40155- 51964
Transcript NameFunction/comments
Pl_108549conserved hypothetical protein
Pl_108550hypothetical protein PHYSODRAFT_476660
Pl_108551conserved hypothetical protein
Pl_108552ribosomal protein L38
Pl_108553hypothetical protein PHYSODRAFT_353568
Pl_108554polyribonucleotide nucleotidyltransferase, putative

Sequence
11809 bases(100 bases per row)
AACGACCACTACTCTATGATCGTGGAACTGATTCCCTCTAGCAACCCAGAGTCAGACACGAAGCTTTATGGGCTGAAGAAAACTGGAATGTGCACTTTCA
AGGCGTCACTGCTTACATACGTACCGGAGGGCGACCGTCTTGCAGGGCAAGGAATCCATACACCTGGTGTAGTGGACATTAGTGACGCGGAGGCGTCCTT
GCCCATGATCTGTGGCAAAATGAAGTGTCGCTACGGGGATATCTCCAAACGTGTTCGGGATTTGTCGGACAAGGTTGGGTGCGACCCAAAAGTTATGATT
GAATGCTGTCGCTAATATCGTTGATCATTGTTTTTTGTGCTTTTAGATCCGTGATGTCCAGACTACAATGGAGGAGGGAACCTTCAAAGCGAGCACGCTG
TTTACGAACATGACTCTGGAGGCATCGAAGAACACACTACAATCCGCAACGCACATCCTCGAAAAATCGCTTGAGCTATTTCATGAAATCGAAGACCTAC
AGCGTTCCTTAACAAACGATTTCCTTGGACGAGAAGAAGCGGCTAAGAAGGAGATTGCAGAACAAGAAGCTGAGGATAGGAAGAGGAAAGAGAAGAAAAA
TACTCCAGATGCTATCCCCGCTGCTGAGGAAAAACAGGCAGCTGCTAGTGCTGTCAAGGAACAGGATCAAGTGACAGCAGAAAGCTGATCAAACGCGTTT
TCAATGGAGGGAATACATGATTTTCACCGTTCCTGCCACTCATACTTCTTCAAGGTTTATGGATGTGCAGAATGGAAATACTCAAAACTAGCCAAAAAAA
GACTTGAAGTCGTGGGCATGCAGACCTCAGAAACATGGCGATGGGGAGATCAGTACTCTTTGCTTCAAACCAGAGGAGTAGAAGCACAACGTGCCGCGCT
TTCTCTTCGTCGAGAGTCGCTGAAGAATGAATTGTTGCAAATACGCCAGCAACAACTCATTAAGGCTCGGAGGGAGCACCGGGAGGAACTGAGGTAAGTG
CGTATTGCTCACTCCATCCAAGATTGAGATGTTATCGTCGTATTTTGCAGTGCTCATGTACAGCGTCTAGAGCAACAGGTTCGCCACTATGAGGTGTGTT
CAGAATAGAAGGATACTGCAGGTTTAGCGTACTCACCGGTGATTGTCCCTAGCTTAACGCGTCGAATCCAGCAAGCATAAACTCGGGGCACAATAGCAAC
TCGTGGACCAGTTCTGCTGTTTTGGATAGAACATTGCCTTCTGCAGAAGTTGATCAGCACTTCAGTGGGTCAAATGAAAGTTTGATTGAGAAACTGGTGC
AACAAAACGAACAAATGATGGCACTGCTCCTTCCCAGGCGACAGTAGGTATCTTGTCGAAATTGCTTTGTAGATGTCGATGTTGTTCACTAATGACTGCG
TTTCCTGCGCTGAAGTGATGCAAATTCTTTGACTACACTCAAGCATACATCGTTGGAAGTTTCTGAAAAATCATCTTCACCTTCAACGGATCTCGGCAAG
GTTAACACTGATACTCAGTCTTTATCAGTGAAAAATACTACAGACGAGAAACCCAATGCTTCAGCACGCGACGTGCTAGTTAAGACGTCTGTGCCAATGT
TCTATAGTCCAGCAGCTCTGTCATGGCTCCCTGAATTTGAGTGGACGGATGAAGATGAATTGGTACGTACATGTCGTTGACGTTTACCATTCTCCATCTG
AACTAGTTATCCAGGCGCTCGACAAACTTGAGAATGATGTGGATATTTTTCACGACATTCCAGGAGTAAACACCAAGCATGGTGTACAGGAAGTTAATAC
TTTTGCGAACACAATTGCCATGAAAGCGAATACATCAAAAGACCAGAAAACACGCGACCGCCTCGAGAGCCGTAAAAAGTTGGAGGCACTACTTAGTGCT
TCGCTTAAAAATGACGGTGGAGGTGCCCTAAGAAAGCCGCGATGGCGTCTTGAAGTTGATGGTGAAAACGATGATGTCTCGTCCTTTGATCCTGTTGATG
CAGAAGTGATGGATCCTTTACAAGTTTTCCGCTCTGCGGTACTAGTGGTATTGTGCGTTTTGCATTTCAAGAAGATGTTGATGACGAAGAAGTTGACAGA
AAAGGAAAGCGCGATGCGGGTACGATGCGGTTCGTGGATTTTAGGGCACTTCGCAATCACTAACATAATTTCCTCAGCACTTTGAGGCGATGCTACGAGT
CTACTTTGATGCTACTCGTATGTGGTTAGGAAAGGTGGTGAAAACGCCATTGCTTTCACTACTTCAGGATTCAAGTTTAGATGTGGATATCAGTACGAAA
GGTGGTATGACTGGATCAAGTCTTCGAGGCTTTGCAAAAAAGTTTGGTGGTATCCTTGCTCGACGTCGCCCAACACAAGATCATGGTCAATTGAGTGATA
GTACTGTGGAACCAGCGAAACTGTTAAAGCTGAAAGTGCGAATGAGAGGCATTCTGCAAGCACTTAGCAAGGCAATAGATAAGAAGGAGGTCCCGTCTGG
GATCTTAGACTTCTTGAAAAGAATCTCGACCGACGGCGTTTACTTCCCTCCAATCGTACGTAAATAATTTGCGTAATGCAGATTGGTACTAGAAACTAAT
CCTTAATCCTCCTTTCAACAGTATCAACTTTTCAACGAGGAACGACGAAGTCTCGAATTTGATGCTTTAGGCGCTACTCGGAGAATGGAAATTGACGGAA
CTAATCTTACCGATGATGAAGATGGGAGAACCGAGGGCTTGGCTTCGAGAGGTAGTGGTTTTTCGCGGTTCAACTTAGTTATGATTAATTTTTTGCTTCT
ACGCATCCTGATTCCACATGTCATTTTGCAGCCTTGGAGCGTTGGCATCGGACCCAAGAACATCAGGAAGCAAACATCAGCAAATTTAACCTGCTTGGCT
ACGCTACTCTACTGTGTCTGTAGAGAGCTTTCACCATTACCACAGCCCACGGAGCCTCCGTCTTCATTCCTCGGAAGGCGACGATCAATAACTGCGAGCA
CATTGCAGCAAACTACAAGTGACGAAAGCCCTTCACCGTTAAGTGACATTGATCCAGCTCTTCTTCCAACAGAACCACAGGATGGGAAACTCAACACAGA
TGCTACTTCATTTCTGTCTATCGACGAAATTGGTCATCGCCTCATTCCCGACAAGCATTTCCCCAGTAAAGATGTCCAGGTTATCCAGGTGATCAAGGAG
CACCAAACGATTCTGCAGGAAGCATTAACACATCTCCATTCCCAGCTTCATAGCTCTCAGTAGTTTGAAGCAAATATCCCATCTCTTTAAGTTTAACGAT
AGTGCCTGCCGCTATCATTGCAAATAGTATCTTACTGAGTATCCTGGCTGCGAATTCCAAGTCCTGTCTCCACGTCTGTTCTCTTCAGGGTTCCTAATTA
TTGCGCAGCCAGTTCGTTAGTGCGTACTCTTGTCGGTCGTTATTCGCAACGCGTTGCTGCTGACCCGGCATTCTTTGTTGCGAGTTGAGCAAGTTCTGCA
CGCTCGGAATTGGATTTTTCCGAGACACAGACCGTGAATCACCCTCCTTTGGGAGGAAAAAGTTGGTCAGCTTACCCGTTTCGTCGTAGCCACGGCGACA
CACCGCAGCTTGAGGTCCTCCCATCTGTATAGGTGGTTGGCTCGACGGCGTCAGATTAAAAGCTCCGTACTGGTTCGGGTTAAAATTGTTGCGTCCAAAC
GTTTGCCGCGTACTAGGCGGCGGGCGGATCGACACGTCCGAGTAGGCATTTGCACGGAATCCCGCGGACTCCGAGTGTGGGGTAAATCCTATAACGTCGT
CATTGCTTTGCTGCTGATAGAATGGCATCTGGTTCGATCCGACGGACGAATCGATTTTCCGCTTCTTGTTCTCCACCTGTTGAAGTCCCGTTCCAAACGT
TGCTGAAGTCGAATACGGGCGTTTGGTCTCAAATGTCGTTGCACTTCGAGTCTTGTTCTTAACCATTTTAGTGCTACCACCAGTTTGTTGCTGTGCAGGT
TGAGGTTGCGTATTCCTCAACATTTCCTTGAGTCGCATTTTCTCCTTCACCACCTTTTGATACTGATCATGTCGGAATTTGCACGCTTTCTTCAGTGCCA
TGATCAACTCTCTCGGATTTTGAATCTCCTCTTCCATTGCTGACGCGTCACAAGTCTCCAAATAATCAATAATACTCTGATTCACACTCGACCGTCGTGC
AGCTTCCGTTTGACGCGTGAGCTCCATTTGATACCTCGCCACTTTAGTCAGCAACTCTGTCTTCGTTGCTTCCAAGCCTCCAACACGTTGAGCCAGCGTC
TGTTTGTCCATTAATAACTGCTCACTCTGGGTGCGCAGACGTCGCAACTCATCCACGAGTCGTTCCTGTTGTTTATTCTGCCACTGGATGCGCTCCATGA
GCGTATTAACGCGGGAGCTGAGCGCCACATTGTCTCCTGACGCTTGAACGGCCTTCATGTCTTGTAATTCGACATTATTAGCGCTTGGGACGTCGAAGTA
GAGCGTGATGAGGTCTGTCTCTCTTGTTTGGCGGCGACAGATAGGACACTGCGTATTGACCTGAAGCGCCTGGATAATGCAAACGTGGTGGAAGACGTGG
CCGCACGGCGCAGCCACCAGGTCGCGACGCAGCTCCTCTAGACAGATATGACACTCCTGGTTCGACAGCGCCGCCATGCCGTTCGCTGCTCTAGGTCTGA
AGCAGTTTTCCGCTGGAAATAACCGGTTATCATACTGAATCCAAATGACCGTAAAAGTCGGACAAAAAGAGGGAAAACACGGTGCTGATAAAGTGGACCA
CATCATTGCGTAATTACGCGCTGGAGGCGTAAAAAGCACCGTTTGGTTTGGAGCTCCCCCGCCAATCGATGGCGCGTGACAGGCGCTTTGTATGGTGTGG
ACGGTGGCGACTCTGCTAGTGCTTCTTAGTTAAGTTTAGAAGACCAACGCAACAAAATGGTACGAAGTCATGGTTCGAGTCTGCCGTGGCCCTACGTAGA
CAACTAATGAAGCCTTGTCCATCCACAGCCGAAGCAGATCACCGACATCCGTGACTTCCTGCAGAAGGCGCGCCGAAAAGACGCGCGCTCGGTGAAGATC
AAAAAGAGCGACAAGGTCGTCAAGTTCAAAATCCGCTGCTCCAAGTACCTGTACACGCTCTGCGTGACGGACACGGAGAAGGCCGACAAGCTCACGCAGT
CCCTGCCTCCTGGTACGACGTTTACGGTTTCCAGACTTTTGGAGACGAGAGACTGACCACGTTTTGATGCTACAGGACTCCAGCGCAAGGATATTTAGGG
TGGCAACGTGCAAGTGCGGCGCATAATAAAGCTCGGTCTTCTTAAGCTTTTTCAGCGTTGAAGGCAGGTGGTAGGTCCGCTGTAGTGGAAGATCAACAGG
GGACTGGCCTGGCAGGGGTGTCTTTCGTAACAGCTTCCCACTTACTCCGCTTCTTGGGCGGATGGAAAGGGGAGTCAAGGGAGTCACAAATACCATCACC
TTCATCCACAGGTCTATCGCACTTTGTTGTCAGAAGAGATCGTTCGGTCTCGTTCGTGTGCTTCGTCGTCGACCTTGTTGTCATCGTGTCTACAGGTTTC
GCGTGGACCAGACGTCACTTGTGAGCAGCTTATAGGACTTGGATGTGGCCGATGAGTTTTCTTGCAGTCACTTCGAGATACTTTGGCCGCGCTTTGTGTA
TCAACTTTATCTCGAAGTTTTACGACGGTAGCACCACTGTTCGAAGAATCACCTTGTTGAATTGCAATGGCATCGGAATATGCATGACATGAATCGAATT
AAAGTGATAAGACAGAAAGTTATTGCCCTCGTTTAACGTGCTGGTTCCTAGGCACAAAGCCGTCTGACCTGCTGCTTTCCACCACAGCACTCATAAATGA
GCGAAGGTCCTCTGGTGATTACGGTGCAGGTCTCCAGCTTTCTTTGATCCAGCTTAAGCAGAATTCTTGCGCGGACTCGGCGAACGACCGGCAGCAGGCG
AGGCCGATCTGGAGCGCGAACGACGCGGGGAGTCTTTACGCGCAGCAGGCGAGCGCGAACGCGAACGACGGCTTGGCGAACGACCGCGTGCAGGGGAGCG
CGAGCGCGAGCGGCGGTTGGAGTCGCCCTCAGGGGCGACACGGACGTAGCTTCCACGGAACTCCGTGTCGTCCAGCTTCTTGACAGCATCTTCCATGTCC
TCCTTCGTCTGGAACTCAGCAATGCTGCATCAAAAACACCACATCATGCACCAAATCAGGAATTGCAACAAGTTGCACTAGCTAAACGATGAACGTACGC
CGAGCCATCCGCCTCAATGTTACAGTAAGTGACCTCACCACCTGTGCGGAGGAAGTCCTTCACGTTACGCCAGTCCACGTCGCGGGGAAGGTCCGTCACA
CGCACACGGAAGTCGGTGCGCTGGGGCGGGTTGCGACCTAATACAAGATCAAAACACATTAGCTTGATATCACGAATCGAGAGCACGAGCAAGTCTCACC
ACGTTCGAAACGGTCGCCGCCACCACCACGTCCATAGCCACCACGGTCATCGTCACCACGACGGCCGCCGCCATCACGGCGACTGCCACCACGAGCGAGT
TCAACACGAATCCTAGCCAAGCACATGACACAATGTCAGGTTAACTACAACCAAATAGATATACCAGTAATATTTCTTACCGTCCACCCAGGAAGTCACG
ACCGTCCATGGAGCGAATAGCATCGTCAGCGTCACGCGGGTCTTCGAAATCCTGTAGAAGAGGTGGAGGAGCAGGAATGGGGACGACGATGGAGAGGCGT
TGGTTGGTACGGCAGGCGAAGATGAAGATGAAGTAGATGATGGCGCGGCACGAAGCGAAGCGAAGCGCAACATGATGGCACGTTGTTCATCTCTCTCCCT
CTAGCGGTAGAAGGAAGCACCGAAGACGGCGAGCGACCCAGACGACGGCGATACCATAATCATCACTGGAGACTCAGCAGTCAGTGGCAACGTTCTACAT
CTATAGATATGCACATGTAGAATACAAAAGACACGCATGTTGCCACCGAGAGATTACTTGGCAGGAATCAACGTCAACGTCGTAGAACCGCACTACCTTC
GACAGTAGGACGAAGAGAGAGAAGAGTAGAAAGAGGGAGAGCGAGGAAGTCGCGCCATCATGCGAGAGGCCGCGCCGAGGAGGAAGAAGCAGCTCAACTC
ACCACGAAAGCGAAGCCAGGCGGGTTACGCGCCACCCAGATGTTGGACACGTGGCCGTAGCGGCTGAATCCGTCCTGGATCTCACGCGAAGTGGCGTCGC
GCGGGAGGCCGCCTACGTACACGCGAGTGCCCATGCTGTTGGTCTGGTCTAGGGTCCTGGAGCGAGGGGGAAGCACGTCGGTCGGCGCCTAGCGTTGCTG
GTGCGGACGGACTGGGCTTTTCGGTTCTGAAAGGGAAGTGAGGACCTCGCTTTCACGCTATAGGACCAGTACTGCTAAAGTAAACTATACATAGGATATT
GGCCAATGAACCATTTCTAGTGGTGATTCTATAAAATCGTGCTGGTCGAATAGCTGAGGAATAATAGCCAACCAGATTGAGATGTGATAAAAATATATAA
AACCTACTCAAGGTTTTTCGATCGTCAAAATGGTGTACAAGTTGTGTAGCTTAGACCACAGCCACTATTGCATCGCGCATCAAGATGCTGTCTCTTGCTG
CTCGTCGTCTTCCGACTACGGCTCGTCGTGCCGCCATTACTGCATCTCACCAACGCGCGCCTCGTGTTGCTTGTGCAGAACAACAGTCTCGTGCATTTCT
AGGCCTCCGTGACTTGCTGTTCGGCTCCAAGAAGCCATCGGAGGAAGAAGAGACAACCAAGGTGCAAGTACAAGAGCAGAAACAGGAGCCCAAGCTGACT
CAGACCCAGACTGAGCAGGTCAATGAGAAGGAACCGGTCGTTGGTAGTTCCGACAGCACGTCTTACTCCGTGGGCAAGCTTGCAAAGCTCGCAGATGGCT
CCGTGTTGGCCTCCTGTGGTCGTACCGTGCTGCTTACGACGGTCGTAAGTGGTGACCACAATGGCAACCCATCAGCCAATACCTTAGCCAAGCGTGACTT
TTTGCCGCTCACTGTGGACTTCCGTGTCAAGTCGCACGCTGTAGGTCTTATCCCAGACAACCAGAAGCGTCGCGAATTTACTGGTAGTGACGAGGAGGTG
CTGCAGTCCCGCGTGGTGGACCGTGCTATTCGTCCGCTTTTCCCACGTGACTATTGTGAGGATACACAGGTGCTGGCGACGGTGCAGTCATACGACCCTA
ACAATGACCCACTCGTAGTGGCTGTCAATTCGGCGTCCGCGGCGCTGAGCATGTCTGATATTCCGTGGAATGGTCCGGTTGGATGTGTGCGTGTGGTCGA
GGTCGATGGCCAGTTGGTTGTCAACCCTACTGCTCCCCAACGTGATGCTGCTACGTTTGATGTGCTTTACGCTGGTACGGCGGAGCGTGCCGTTATGGTG
GAAGCTTCGGGTGATGAAGTAACTGAAGCGCGCTTTGATGAAGCGTTGGATCTGGCGCATGCTAACGTGCGGTCGGTTATTGAGGAGCAGGAGAAACTTG
CGGTGGAACATGGCAAGAAGAAGCGAGTGTACTCACCTCTGTTCATTCCATCGGAGGTCTTGGCCAAGGCAGAGGAGCTGGGTCGCGCAGATATCGAAGC
ATTGATTGCTAGTGGACGTGTTGGTAAACTTGCTCGTCAGCAAGGCGAACGTGAAGTTTACAGCAAGATGCTGAATGGCATGCGTCAGCACTTTGCAAGC
TCATCTCCCCCCATCGATGATGCGGCTATTCAGCGGGCCGCCCATGACACGTTCCAGCGGGTGCTTCGTGACCGCATTTTGACAATTGCGAAGGAGACGA
AAGGACCGAAAAACAAACCCGTGCGACTTGATGGTCGGCCGGTTCGCATTGTGCGTCCACTGGAGATGGATGTTGCAGTGCTGCCAATGGCACACGGTTC
GTCTCTTTTTGCGCGTGGCGAAACCCAGACACTGTGCTCCGTGACGTTGGGGCCTTTGGAACGGGGTATTCGTCTTCGTGGTGCTTTGCACGAGGCTCGC
GAACAGGCTGAACCTGATGCTCCTTCACCCCTCAAGCATGCTATGTTGCACTACGAATTTCCTCCGTTCTGCGTGAATGAGACCGGTCGTGTCGGTGGAA
CTAATCGGCGCATGATCGGCCACGGAGCTCTGGCAGAGAAGGCCGTGTTGCCGGTTCTGCCGTCTATCACTGAGTTCCCGTACACTGTCCGCATGACCTC
GGAGGTGGTGGGATCGGATGGCTCGTCATCTATGGCTACGGTATGTGGTGTTTCACTTGCGCTGATGGACGCTGGTGTTCCCCTTCGCCGTGCTGTTGCA
GGTATTGCTATCGGTCTTGTTACTGCCGGTGACCCGTTCGCTGGCCGAGAGAAACGCATTGAAGAGGGTGATTATCAGTTGGTGACTGACATCCTTGGCT
CTGAGGATCACTACGGTGACATGGATTTCAAGGTGGCAGGCACGACGTCAGGTGTGACGGCACTTCAGCTGGATGTGAAACTTCCTGGTGGTGTGCCCCT
TTCTGTCCTGAAGGAGGGTTTGCGCGAAGCTAAACATGCCCGTCTGCATATTCTGCGTCGCATGAGCAACGAGCTCGCTGAGCCCCGCGCGACTTTGAAG
TCTGGTGGCAGCGCACTACCAAATGTGAGTATTGAGTGCGTGATTCCCACGAACTTAATCGGTGCGTTAATTGGTGTCGGAGGCAGCAACATCCGCGACC
TAGAATCGCGTTTCAAGGTCTCCGTGAGCATCGTGGACCGCCGTGAAGGCATTGTGCGAGTCGTGGGTGCAGCTGGAGACGCCGATAATGCTCGTGAGTG
GCTGCGTACAGAATTGGCTGGTGTTGCCAATACTGGCCCTCGTGGCAACAACAACAACAACAACAACGGTAACAACAGTTGTGACAATGAAAACAAAGGC
CGGTCATTCACTTTCCGCAAGGGCGAGCGCTACACTATGCGTGTGACACAAGTCATGGATTTTGGTGCCATCCTCGAGTCTTCAACTGGCCAGCGTGGTT
TTGTGCACATTTCGGAGCTCTCTCGCGACAAGGTCAGTAACATTCACGACGAGGTATCAGAGGGTCAAGAGATGGAGTTCGAATGTCTGCAGGACGGTGC
TTCCGGCAAGATGTCGCGCCGTGTGCTGCTCAGTGCAGAAGAGAGCAAGGACTCCTCGACCGCTTCCACTACCTCAAAGGACTCGGAGCCAACAACTGCA
CGAGCTGACCACCATCACTCGCGCCGACCGTCAACACCTCGTCGTTCCAAGACCACCCGTCGTCCGCGTACTCAGTCCAAATAGGTAGTTACTTCGAAGG
AAGAGATTATCTCTTTTTATTGTGTTTAGAGCCCACAACGCACAACAACAAGAAACATTTGCCATGCTCGTTGAAATGAATACTGTATAAATGATTATTC
AGCAGACTTCTGGTATTGTAGTATGCAAGTTGGTCTGGGTAAAGCTGGTTTGGATCCTAACCAGCCATCTGGGGTGAGACTACTGGGTTCTGGTCCTCGG
CGAGTTCCGTCAGCTTGTCCAATTTCATGGGTTGTTGATGCTGTGCTGTCTTATTGTCGAGGCGTGCATTGAGACGTGTGATACGCATGTTCATTATTTC
CCCAGTCGTATTATTGTTGTCAGCACCGGGGCCCCCGCTACTTGGAACTGATATTCCGCTTCCTGTCGGTAAACCATTTTCTAGCACGTCCAAGACATCC
ATAGGAGCTTCCGCGAGATGTGTGACTGCCCCAACAATGAGGTCAACTAAATCGCCAATCTCGCTGAAATCCAGAGTCATCACTTTCAAGGCCACTTTGG
CAAGTTTGAAGGTAACCAGAACCAGCAGCACCGACCAAGCCCAACAAATGCGCCCTACTCGTTTGCGGTATGATTCGGTGACAATTGCATGCGTCACATA
CTGCTTGACATACGTTGCAGCAGTGTGGATTTCGCCTAACAATTTGTTGTCATGATCTTCGTGAACGGCCACGAAGACATTCCAGTCCAATGAGTCTTGG
CCATGACGGTCATGATATCGGTTCAATGTCCGCGCCAAATCTGTCATCTTGGATCACCCTCAGTGTATTGACCTTCGCTCACAATTGTGTTGATGCAGCG
CAAGACAGCGTTGATACGCAGATTGACTCTGGAGGCGACACGTTGCTCCCAGTCTCCTTTTTTTCGAGAAGCTTCACCTCGGCTGCACAATCGACCGTTC
TTAGCAATCACGTCACCTAGCGTGTAAGCGTCCTGCGCTCCCCAGTTGAAGATCAAATTCGCGTACCGGATCCGAAATACTTCAAACTGCAGTCGATGAG
CATTGTCAATTGCTTCCAGTGACTGCTGGAGTACAACGATCACCAACTTTTGTTTTTCAATCGACTGCAACTGGAAAATCTCCTCCACAGCGCGCACATC
TGTCACCTTATGCGCGATTTTGTGCATGGTGATGGTCTTCGCTGCTTCCTTCACCTTCTTCATCTCCTCTTTCGTAAACCCATTTCGCTTCAGCCAGTAG
TAGAAATCATCGTGAGTCAGAACTGGGGCTGATCTCTTAAACTGGCATGATTTTACTGCAGCACTGATTGGCATGAAGAGCACATAAGGAGTAAGGAAGA
CGATCATAAGCGCAATCCCGCGGATATTGCAAATGAAATAGACGATGCCTTTAAGTGGTAAGCAAATGTAATACTTGATCTTCGCACATAGAGTCAGGGG
TGGTGCTGG