Description :
From Genome Similarity Track
Location :
contig_26:401520- 407648
Transcript NameFunction/comments
g6784.t1XP_009527199.1 hypothetical protein PHYSODRAFT_502426 [Phytophthora sojae

Sequence
6128 bases(100 bases per row)
CAGTAGATCGTTTTCGAGCTGCAACAACTGGATCTGGTAGCCGTTGAACTCTTGCTGGAGCTGGCGCTTTTGCGTCTCCAAGTCGGGCTGCTCCAGGTTG
ACGACGTTCGCAAGTAGTTGGTCCTCGAGCCCTTTCTCCGTCACGCTAAAGTCGATGAGCGTGCAGTACGCCAATATTTCAGGTCGGTAGTGTGGGTTTG
GCAGCTTTGTGTGCAGGAACAAGCGGAAGCGCGGGTCCACCTCAATCTCCTCCGCTGCAAACTGCAAGAACCAATTGCGCCCCTTCTTGTAAATCTGCCG
CATAATGACGGGCTCCAAAGACGCATCGATCGCCTCGCCTAGGTTTTCCAGAATGACGCTCTGTCCGCTGGTAATCGCGATTTTCAACGTGGTCGTCCAG
TTCTTTTGAGCAGGCTGTAGGATGACCAGAGACTGCCCTGCCGACTCTTGCTCATCGCGGCGTTCGGTTCCATTCTGTTTCTTGTGTCGGAAGTCGCGAG
CACGCAGCCAAATGATGCCTTGCAGTTGGGGGTCTACAAGGAGCGGCCAACGCTGACAAGACGTAATAATGCACCCGTTCTCGATTGAGATACGATCCGC
AGGCAGCCCTTCGTTCATCCATTGAGCCAGATCGCTACTGTCGCTTAGCACATCAAGCGGGTCGACGCCCACGGTGGGTGACGGTGCAGGCGATGAAGCT
TGTTCAGGTGATCCTTCCGTATCGGTGGCCATCTCCCCGTTCTCACTAGTGTCGACTCCGCTTCCGCTACTGGCGCTGAGGTCTGCTTGGCTTCCTAGTG
TGATTGGGATCTCCCGGGTCACGATGTCTGGTAGCCAGGTGTGTTTCCACAGCTGAGCACGGAAGCTCGCGTTGAATGCGCCAATGTAGCTGACAAATCC
CGCCGCAAGCAGCGAATCGCCGATCAGTGAACTCTCACCAGCTCGTAAGACATCGATCTCATGACCCCATCTCTCATTCTCCGAAGCGAGCCCATTCACC
AGCCGCTCCGCCAGCGATAGTCGCTCCTGACAAGCCTGTGCCTCAGCCTCGACTTTAGCCTTCTCATTCGTAGCGTCTCGGAATGAAGCTTGTAGCGCGT
TAAGCTGGCTTTCTACCTCCGCCACCAACTTCTGCACTGCGGCCAGCTCGCTATCCGCCTCTGCCTTAGTTTGACGTGCTTTCTCAAGGGTGTCCATCAG
CGGCTTGACGCGCACGAATACCTGATGAAACGAGATGATGTTGACAACCCACACGCACAGGTTTGCAGCAGCCAAGGATTTGCTCTTCATCTTCTCGTAG
TTAAAGTTCGGGTCTTCCTGGATCAGGGGCTCGACACGTGCCACGACTTCCAGGGGGATATTCTCCTTATCATATTGCTCCAGAGATTGCTTAAAGACGT
CCACTTTGGCCATCATCTTCTTGGCGTTATCCCAGCTGAAGTTCTTGGTTTCTTTCTTCACCATCATTAGAACGGCTGCCGTCACCTTCTCCACCCCAGC
AGGAGGTTTGCCCATCGACTTGAGCTCCGTAAGAGATGCCTTGTTGAGGCAATTCACAGCTTGCTGAGCCGCATCCAAGGCTGGTTTGGCAATCGCCAGC
TCGACGGAAGCCTGTCCTTCAATTTGTGATGCGATTTCTGCGGCCTGAGTAGCCTTCGCACGCTCTTCGTCAGCACGACGCTGCTTCACTTCAGCATCTC
CACGTTGCTTGCCCATTTGCTCGAGCAAAAGCTCAGTCGCTCTCTTTCGCTCCTCCACTTTCTTCATCGTCATCCTCAGCTCGTCTTGGAGTCCTGCAAC
ATCGAGCGACGTCTTCTTGAGTGTTGCCAGACCAACTTCTAAGCGCTTGATCTTCAGTGTTTGAGATGAACGCTTTGCTTCCAAGAGCGACTTGTAGAAA
CGGATGAGCTCCAAGAACGACGTCGGTGTCACGTAGTTGTGGCGCCCGTAGCTCTTGGTATACATCGTACAGGCTATAGTGACTGACATGTGCATCTCAG
CCATGTGGTGGCAAACGTTTTCCTGAATTGCACGCGTAGACAGCTCCACATCCTGAAGGAAATTGAGTGACACATCCACTAGCGCTTCTTTCGGCCACGG
GTGGAACCAATTCATAGTGCAGCAGCTGATCAGCGAAGGGAAATTCCTGCAGCGAGTTCGCAGATCACCACCCACCGGTGAAAAGGCTAAGATGAGATGC
AAGTTCATGCGCACACGCTCATAAAAGAACTCTTGAAGCTGCTCCTTTGTGTCGGGGATGCCGCGTGCCTTCGCTTCCATCCGCAAAGACCCGGCCATTG
ACTCCATTTCTTCGCTGGAAAACAAATCCGCAATGTAACCAGACGTCAACACGTCGCTCAGCGGAACCAGAAAGCGGTTGTCAATGATCTGAGAGTCTGT
GAGTAGCAGCACAATTGGCTTGGCAGGCCGGATGCCAGCTTTGCGGTAGACGTCTTTTAGATCTTCCTTCAGCTCGCTCATCCCGTAGGTTGGGGACGCA
CTTGTAGTCAATGACACCAAACCGTATCCGCAGATAAACGTTGCCAAGCGTGAGAGCGACTGCTTTCCTGACCCGCCAACACCGATCAGCAGCGCGTTCC
CGTGAGGGTTTGCCAGAATGCGAACGATTCGCGTCACGTGTTCCAACGCTTGGTCGAACAGCACAAGACTCATTACAGGATGCGTCTCGTTGTACTCAGC
GAGTTTCCGCTCCAGGCAACTAGTGAGTTGCGCTTTCTCAACGACAGGGACGTAACTGAGAGGACTACCTCCATACTCGCTGTCCATGGACATTGACCCG
GAGGGTGCAGCGCCCAAGAAGTTCACACAAATGAGGGGCGCAGCGAAGACCTCTCCTTGGTCCTCTTCAAAGTTCTTCTTCGTCTGCTCTACAGCCATCT
CTGCGAATCGTTGAATCTCGCTTGGCGAGCTCATGCGGTCGCTGAAAACACGGAAGCACTCGTGCATCCAAAGACGACAAAACTGGAGCGAGTTGTTTAG
ATACGCTTCAGGCCGTGCCATAAAGATGCCTTGAAACAGCGAGCTTAACTCGCGCATACTGAACACGTAGTGGAACTTCGTGGCAGTCGGGAGGAAGTTC
GCACGCACCTCAGAGTACAAGTCAATGGTTGCAGTGATGATACCAGGGGACAGCTTCTTGATCTTCTCAGCAAAGTTTGTCAGGTGCTGGTTTAGTAGGG
TGGAGTAAATGGTCGTGAGATCTTGCTTGGACGGCATGCTGATGCACAACGTCGAGAAATGGCGGTGAAGACGAGGATTAACCGTAAACGACCCGGCCTT
GTTGTTCATGCAGGCAAGAAATTGAACGTCCTGGATAATCTTCTTGGACGAGAGATCATGGCGATCGTACCATGAGTTGTAGTCCATGTACTGCCGCAGC
AGCGCAAGTGCAGTCTGAGTGCCAAACTCTTCGACGAACGGCATGTTGAGATCATCCAGGAAATAGATGAGTTTGCGGTTGTAAAGCGGACCAAACACAC
GGCCTGACCTTTTCTCGAGAAATTGCTCGAGACGACCTTGCAGTTCTCGAGCGTCCATGTAGTGATGCATACTCACGTACGCGAAGGCAACATCATCTTC
CAGTCCCTTCATGTGCTCGTGGACCAACGACGACTTGCCCGAGCCGCTGGAACCGACAAGAATTGTCGGGTTCCTCTTTCGCAACAGCAAGTCAATGATG
GAGTGCACACGGGTAGACTCCATGGTGGGGATAACAAGCGCATGAAAGGGGGTGTCGCCAACCGCTGTGTGCGCTGGTACCTTGTCGCCCCAGTAAACCA
GCTCATTCCGTGTGATGTCGTAGTAAAAATCGAACATGTTTGCGTTGCCAGTCGCCAGCATTGCTGCCATATTCGTGTCAGCACCTCCTTGAGTTAAGGG
ATACGAGGTCGATCCACTGTTAGTTGATACAGCGGCGAATTTGTACTTGGCGATGGCCTTGAAGTGCGTGGAGAACGCGATACGATCATCAGTGCCCTTA
TCGCTCGCGAGCGCACCCCCAAACGCCCACATTGCACAGTAGACAAACGCATTCTCTAGCACTTCAGGGGTTTTCTCGTGCTCGCCAACGGAGCTCAGTA
AACCGTCCAACAAACGGCACAACATCTCCACCATCGCAATAGGGACTACTGGTACAATCGTCTCGGCCTTAGTCTCATCAAGTGCCAAAAACATAGAGTC
CATGTACTTCTGGAAGAGCCCGGGAAGGATACCCGCCTCAGCACCGCTGTCACGCTGCTGCAACCAGGATTCAACAGCAGGATACCAACCGATATGGCCT
TCGTCTACGTAGATGATGCCAGCTCGAGACACGGTGGCTGGTGTTGCGTTCACAAGCGACGAGATCTCAAATACGAGTCGCATCGACTTTGTCAATGGAA
TGCGCTCGTTCGATACGAGCGTGAGAACCTTGTTGTCGTCCATCACAGTGTTCATGCTTTCGATCCAGACTGCATCGATGTCGCCGTCCAAGACTACCCA
CTTGTACGTTTGAGATTCGCTAAACGGCGCCGCATTCTTGGACATGTTTCGCATGATAGCCGATAGAACGCCGTCTTTCCAGTCATTGTCAAGAGTCATA
TAGCCGTAGAGTTCATCTGCTGTGATGGCTTTCGGGTTCACGCTCTCGAAAACGGTCAGGTGCTTAGCCAACGCATTCCCTTGCTCATCAGCGTTGTGAC
AGGCCGCTAGTGTGCTCCAGATTGCACTTTTCCCGCATCCTGCTGGACCGATCAGCATCACACTGTGACGCACCTTGAGGACGTCTTCGAACTCCATCAT
TTTCTTCAGAAACCCATCTTCCGGCTGAAGCTTCTTCTGCGCGCACACACGAGCACACTTGGTCTGTAGAGTGTCGCTCTTTAGGTGCGGGAGCTCTTGG
TTAGGGAAAAGGTCTCGGAGCAAGCCCATGAACACTGGGTAGTCTGGAGGCAGGATCCGCGGCGTGTTGAAGTCTCGAAGCACTTGCATCAGCACGGTCT
CTTCTGATAAGGTTGAGTGCGCACGACGCAGACTACCGGCGACAAGAAGCACCGACTTCACCGAGCGTAAGCCCCAGTCGTAATGCTTCTGCTTCGACAG
CAGCTCGCTGCTGAGATCGTAAAGTGTGACAAACTTAACTGAGAGCGTACGCGCCTTCAAGAACCCCTCCGCCATGAGCATGTTTTCACAAATGGGCTGC
AGGTCAGGTTTGATCATGGCACACGAACGAAACAGCGCCTTCAGATTCTCCGGTAATTCCGCACGTCCGGCGTAGCCCGGGTTCATTGTGATGAAGAACC
CTACTGTCGGCACTAGTGCGATGGTTTTCCCAAAGAACTCGCAATTGCCCGTCCGTGGCATTGCTATGGGCTGCTGAGCGCTTCCCTCTCCTGTAGAGGA
GCCAACCTCACCATTACCAGTTGACGGGCCCCGGTTTGTTGCGGCTACCAGCAGCGTCGTAGCATCCAGCACAGTCTTCACTTGCGTTGCTACCACGGAC
AGCACCTCGACTGAGATGCGGTTAAATTCGTCAAAGCACCCCCACGCTCCAGTCTGAGCTAGTCCACGAAAAATGTTTGCCATCGTCAAGTAGTTCATCT
GGTCACTGCAGTTGAAAACGTAGCACTGGAGTCCCATTCCTCGAGCAAGATCCTTTGTCGTCTCGGTCTTTCCTGTACCGGCAGGACCCGCTGGAGCTCC
ACCTAGACACAGACGGAGCGCGGTTGTAAGGGTGACGTAGCAGCGATCGGTGAGCGGGGTGATCACCAAACGTCCACAGTTGCCAACGTACTCATAGCTG
TAAAACGAGCGGAAGTCACAAATCTTAATGTGCACCTCCTTCTTCTGGCCTGTGCTCGTCACGACAGGCGTCGAGTAGTAGCGAAGTTGCGATTGCCACT
GAAAGTCCAGTGCGCTTGAAACCTTCTTCGTGATGAGGGATTGTACCACATCACGCGCATGAACGTCAACAGTGATCAGGGTGATGATCTTCTGGCGGTC
GAGTGCTCCAAGATGTCCCTGAACCAGCTTTATCAGCTCTTCCAACCGCACAGTCGACACGTCGTAGTATTTCTTGATGGCATCCTCGGTGCCATTTTCA
AACTCCTCTAGCGCGCTTTCAACCTCTT