Description :
From Genome Similarity Track
Location :
Scaffold_192:4015- 6769
Sequence
2754 bases(100 bases per row)
TACCTCCAGATAGATGTGTCCGTCATGAAATTGACTTAGTTCATGGGACGAAATACTGTGTCATATGACAGTGGCCCTTGCCTAAGGAGCAATGTGATGC
CATTGATGACTTCTTTCGTGCTAAGTACGAGGCAGGAATGATTCGTGAGAGTAAATCTACATGTTCTACACCGGCATTTCGTGTCAAAAAGCCGATTGGC
AAGTGGCGTATTGTGAATGCTTACAAGCTTAATGCGGCTACTTTTCCGGCAAAGACATACAGTCCTCGAAAGGATGTTCTTCAAAACAACATGGTTGGTT
GTACTATGTATAGCGCACTCGACTTGGTTGATGGATATTATAAATGCGAGCGAGTGGTATTCCGCTTACAGCAGTGAGCACCCCGAGTGGTATGATATGG
GAATGGCAGGTGATTTCCCAAGGGCTGTCTAATGCTCCGACAACATTTAATCGTCTGGTGAAGCAACTTTTTGTGGTTTACGCACAGACGCACTTTGATG
ACATTTTTGTCCATAGTCGTGCCGAAGAAGGTTGGTCAGATGTTAAAAATCACATCGGTCATTTACGAGCCGTGCTCGAGTGCATGCGCACTAATAAACT
GTACGCCAACGCGTCTAAATGCATTTTTGGTGCAGGGGAGGTTTCTTTTCTAGGATGTTTCTTTGGGAAGCGCGGCCTCAGAGCGGATCCCACTAAGGTC
AAGGCTATAGTGGACTGGCCGATTCCTAAGAATCAAAAAGACTTGCGTAAGTGGACTGGCATTACCAATTAATTACACAAATACAGTGAAAATTACGCTG
ATATGGCTCAGCCATTAACTGATCTCCTTAAGAAGGACACAGCTTGGCGTTGGGACAACACACATGATGACGCATTTCGGGCAATAAAGGAAAGACTCCT
CCATGCTCCCATTTTTGCATTACCAAATCCTGAGTACCCTTTTCGTGTTGTCTGCGATACATCCGATTTTGCTATAGGCAGCGCCCTATTACAAACAGAT
GCTGCAGACCGCGAGCGAGTTATCGCATTTGAATCACGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTTCATGACCAAGAGATACTTGATATGAAAT
ATGCGCTCGTTAAATTTAGAGTCCATCTGCTTGGCTCCAAGTCATTCATCGTCTATACGGATCATGCGTCATTACGCACGGCAACACAGTCGCCTCACCT
CTCTCAAAGAATGGCTCGGTGGCTTTCCTTCTTTGCGGAATATAACTTCGAGGTCAAGTATAAGCCAGGCAAACAAAATGTGTTAGCAGATGCTCTCTCT
CGCAGACCTGATTCTAAGCTTGCTCATGTCACGCCTTTGTCGTCTCCAATTAAGGAGTTAATTCGTGTAGCATATCCACGGGATTCTCAGTGTGTGGCAT
TCTTTCAAGCCCTTGGGAGTGAAGAATACAAGGACTCGGACAGTCAATTATCGGCACGCTTGCGGGCCAGTCTACATCTATATTCCATCGATAATGGTCT
CTTGTGATATCGCAAAGATGTAGCGGATACCGCTCGCATTGTGCCTCACAATGAGGATTTAAAATATCGAATCCCGTTTGAGTCCCACGATACTGCCCTC
AGTGGGAATTTTGGCCGGGAAAAGACTTATGGCTTTGTGATTCAACACTACTGGTGGCCCAAACTCTACAAATGGGTGAGCACATAAGTGCGTACATTGG
AAACGTGCTAGAGGGTCAAAACCTCAGCACATTCGGCTGCGCCACTCGCCAGTTTACCTTTGCTCACGGGGTGTTGGGAGTCCATCAGTATGGATTTTGT
GTTCGGGCTTCCTAAAGATAGTGACGAAAATACGGGTACTGTGGTCTTTGTTGGCCGTTCAAGCAAGATGGCTCACTTAGCGGCAGTGCCGGATTCCATC
GATGACAAAGGTACAGCTATGCTGTTTATCGATCGTGTGTTTCTTCAAGACGGGTTGCCGCTAGCAATCATCTCTGATAGCGACCCTCGCTTCACAGGCA
AGTTTTGGACTTCCATTTTCAAGGTGGTTGGTACGCGAAAAAACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAGACTGAGCGAGTTAATCGTGT
CATCGGCGACGTCTTCGCAGTGTTTGTGCTGAGCCGCCTAAGTCTTGGAGCTCGATGCTCCCTGTCATTGAGTTTGTTTTGAACAACGCTGTTCATGCCT
CGACGGGCGTTACTCCCTTCTATGTGAATAGCCTCACCCCCCCTCCCGCGTTTCGCTCACGTTACCACTACATGTTCTGGTCTTGGTGGGGGTGAGTCTG
CTGACAAGCTTGCTGAAATCAGCCTTACTACTGTGCAGAAACAAGTGAGCGAGTTTCTCGCGAAGTGCTTTAGTGTCGTACGACATATGCGTGATGCAAT
GGCTGATAGCCAAGACAGACAAAAAGAATAAGCTGATGCTAAAGGCAGAGGATGTATTGATTCTTATGAAGTTCGAGACCAAGTCTTATTAAATGCTAAA
AACCTACCTTCAAATATATTGTCTGCCGTCTTCAAGACGAAATTGCGTCCGCGCTTCATTGGACCGTTTACGGTCATAGCGAAAAAAGGCCTTGCATATA
CGCTCAATCTCCCGCGCAAGTTGCGCACACAACCAGTGTCTTACGTTGGCTTGCTTAAGCCATATCATGATCCTTCTCTCGTGAACCGGAATGCGCTTGC
GCCTGAGGTGGGACGTCTTCCCCGCTAGCTGCATCTTCGTCAAGAGCTTCACCT