Description :
From Genome Similarity Track
Location :
Scaffold_17:40137- 42014
Transcript NameFunction/comments
Phyke_g1132cleavage induced predicted protein
Phyke_g1133hypothetical protein

Sequence
1877 bases(100 bases per row)
CTGCCAGTATCCACTTATACTATGACGACGACGCTCGCTGCATCTATCTGCTGGGAGTGGCGAGACCCGAGAGTCTCTGCTTCTCTGCTGATGCAGGAGC
CAAAGCAGCCAAAGGTAGAGCCCCAACACGTCGCCAGTCTATAGCTGAGGATATAGAGCAGACGCCACAGACTGAAGCCCAGCGACTACGAGAAGAGATG
GACAGTTTTGAGCGtgagaagctcaagatgcAGGCACTATTATACTCCAGTTGCAACATGTTGTTTGTGCTCCGTGAAGATGCACGAGTGACGACTACAG
TATTGAAGGAGGTGCGTGCTTTAGCAGtggagaagacgcagctgctgagctcTGTAACGTCGTCGGCGAAGCATTCGAAGCGGGACGGAGGACACTCGAA
AGgatcttcgtcgttgtcCACTGGTAGTGGGAATGCCTTCGCACCTGGTCGCTGTGTTCCGCTCGTGATGTACGTCGTACCCGCACCTGATGAGATTTGG
GATGCTACGTTGAAAATGCAAGGCTCTACTGGACAAGCACGGTCAGCTACGGTGGCGTATTGCAAGGCACTGGAAGGACGATTGACCACACTCTTCAGAT
CTCTTCGTGGCAGTACTGTGGGCTCTGTACGTATGCGTGATGCACTCAGTGCTGCAAATTTGAGCAAAGAACGGCGTGTGTTCAATATGGACCCAGCGCA
CAGTgtggcggtggtgtcaaGACGTACAGCAACATCCGATGGACGAGCAGAGGCTCAACTTGAGGACCTTCTGGATGCACTGGATGCTGAGATCAGTATT
GATGATATCTTGGCGGATGATTCGCTGCTACAGCCgctggaagacgacgacaacggCTTCCAACGGATACATCAGTACCTGCAGAAATACCTGAATTTAC
TATTTGTAGGCACCggaggcagcaacaaggaTGGCGGACGAACCGAGCTGCTCACGCCATCGCAGTGGTTGAAGGGCTTTCACGCGCTTGCCAAAGCGAA
TCGTCAATGAAAACTGGATTTGCTCAACTGATTTTACATTCCAATCCGTTCATAAAAGTATCTGGTCATGTCGCTGCGCTAGTCGCTGGCTGGATAGTGG
TGATACACCGCGGATGTGAGCTCTATTCTTACAGGTTTTTCCTGTAAGGAGTCCTAAGAAACCTGTCGATGCGTGGGACAgacttcttttttttttctgt
cttctttttttttttcaagcAGCGAGGAGGCGTCTTGGTGAAGCGTCGGCTGCATATCTGGTCATTCGCCGATTTTACTCCTTCTCGACAATCCCCTTCA
ATCTCCACTGACAACAGAACATGAAGCTCCTGACGTCTCTGATTTTCATCCTCGCAATCGCCACGGCATCGGCCCAGATGACGACAAACTCCACGGCCAC
TACCGGGTCGACAGCCGTCGCCGCTGCGTCCGCTTCTGGGAGTGCCAGCATCGACTCTGCGTCCGGAAGCGAATTTATCTCTGGTGGTACCAGTACCACC
GTCACCTCGACCTCTGGCAGCGCGAGCGTCAGCTTCGACTCCAGTTCCTCCGAAGCCAGCGGCTCCGATGACACATCCGACTCTGCATCTGCCAGCGGCT
CCGAAGATTTGAATATTCAGTCTACGTCGCAATCAGGTGACGAATCCAACGCTGCCAGCGACAGTGGCAGTGAAAGCGCTTCTGGAAGTGACAATCCACT
CACTGGTGCGTCAGGAAGCTCGAAATCGGCGAGCTCGGATGCTGTCAGCGTCCAGACACTCGCGTTCTACACGTCGGCGACCATCgtcatggctgctgct
gcactgtTCTAGGCTCCCTTGCATCTTCCCTTTGTAGCTTAGCTGCTATTGAGGCAGTATGTATGGATTAACTAGCA