Description :
From Genome Similarity Track
Location :
contig_14:401272- 402997
Transcript NameFunction/comments
g3548.t1XP_009524530.1 ABC transporter-like protein [Phytophthora sojae

Sequence
1725 bases(100 bases per row)
CCATGCACCCTCAGCTGGAAGAAGCTCAGCTACACGGTTGAGGTCAAGAAGACGGAGCGATGCCCCGACGGGAAGAAGACCATCCTGAGCAACGTCTCTG
GTCGATGTGCGCCCGGTGAACTCACCGCCGTCATGGGACCGTCCGGGTGCGGCAAGACCACGCTGCTCGACATCCTCGCGGACCGGGTCAGGTCTGGCAG
CATCCAGGGAGAGATCGCTCTCAATGGCGAACCCCGCAACGTCAAGACGTTCCGGGGCGTCACTAGCTACGTGGCTCAGGAAGATTCGCTGCTCGGGTCG
TTCACGGTGCTGGAGACGTTGGAGATGGCGGCAAAGCTCAGTCTGCCCAACTCCGTCACGCACCAAGAGATCGTCACACGAGTGCAGGTGGTCATTGACG
AGATGGGGCTGCGAGTGTGCGAGCACACACTGGTCGGGGATATCTTCCGCAAGGGCATTTCGGGCGGCCAGAAGAGGCGGCTAAGTATCGCCATTGAGCT
GCTATCGGACCCGTCCATCTTGCTGCTGGACGAACCGACCTCGGGGTTGGACTCGGCCTCGACGCACAATGTCATGCAGTTCGTGTCGAGGTTGTGTCGA
GAGAACAAGACGGTGATCTGCACGATCCACCAGCCTTCGTCGCTCGTGTACAACATGTTCACGAACGTGGTTATCCTCACGGCAGGCGAGACGGTCTACT
TCGGCCCTCGAGAGCCCACCATCGACCATTTCTCGGCTGCTGGCTACTCGTGTCCGATGTACATGAACCCGGCGGAATACTTCATCAGTTTGGTGAACTC
GGACTTTGAGGGCCACGCTGACATCAAGCGCCTCGTGGCCAGCTACGCCAGCAGCGCGATGGCTTTGAAAGTCGTCGACAACATCGAGGCGGACGCTGCG
GGAGTCCACAACGCGACCCCCGTCGTCCCAGTCAAACCTTCGGCGCTACGCCAGTTCTGGGTGCTCATGCAGCGCAACTCGCTCAACAACGTTCGCAACC
CGGGTATTTACTGGGTCCGACTCGCCATGTACACCATGCTATCGTTCATGGTGGGCACCATGTACCTCTCCACCAACGACGCCATCTCCGACGAAGACAT
GGTGCCATTGCTCTTCTACGTGCAAGCCTTCCTGGTCTTCATGTCGGTGGCTGTGCTGCCTTTCTTCATTGAACAGCGGGCGGTGTTCCTGCGGGAGCGT
GCAAACAGCGGCCTCAACGTCTTCAGCTTTGCGCTGGCGAACTTCATCGCGACTCTCCCCGGCATCTTTGTGATTGCACTCGTGTCGACGCTGCTCGTGG
TTCTGCTCTCGGGTCTCAACGGGTTCTGGTACTTCCTGTTGAACCTGTTCCTGTCGCTGGTAGTGGCCGAGTCGCTCATGCACGTGATCGGAGCCGCTGT
CCCGCACTATATCATCGGCATCGCTCTGGGAGCAGGCATCTACGGCATGTTCATGCTGTGCGAGGGCTTCATGGTGCCGAAAGACGTCATCCCGGACTAC
TGGATCTGGGCCTACTACATCGCCTTCCACTCGTACTCGTTCAAGTCGTTCGTGTACGAGCACTTCATCCACGTGGACACCCCGGCAGCCAAGGCGATTC
TGGCGCGACTGAACCTCGAGGACGTCGACACGCCGCAAAACATGATCATCCTGGCGTGCTACGCCATCGGCCTGGAGCTCATCTTCACCTTCATCCTGTA
CAAGTTCCACACTGGGCGTAGGTAA