Description :
From Genome Similarity Track
Location :
contig_47:401243- 402429
Transcript NameFunction/comments
g9271.t1hypothetical protein

Sequence
1186 bases(100 bases per row)
ATGGCAGGGTTGCGATGAATGTAAGGCAAGTTGCTCGGGAGGGTCTTGATCTGCATGCGAATTCCTTGCTCCTCATCAATGGTCACTATGCGTGGTGCTG
GTGGGGTGCTGTCTGCCTCGGATCGCGCAGGTCCGTCGGTGAGCAACTTGGCTTCGACGCGCTTCGTGATCGCTGCCACTGACCGAACAGAGTGCACTGA
GCGAATCGACTTGCACTCAGACAACACACTGCTTGCCACACTCATAGCGTCGTCGTCGCCACCCTTGGCATCTGCACGGTCCCATCCCAGCCGAGATAGA
TCGTTCCCGTTGAGAGCGCCACCTCCATTTGCTAATTCCTCAAGACGCTGCTGTTCGCGTTCGCAGCGCTTTTCCTCAGCCTCCTCATAGTCTACGATAG
ACTGCACCTGTGCTAACTGCTGCTCTACTTGAGCAACACGCGCCTTGATCTCCACGTCGTCCATGAACTGATCAATATCCAGGTTATTTGCAAATTCAAT
GAGGTCGTTGGCTTCAGCGTCCTCGAGGCTATCAAGTTTCTCATCAGCTGTGGCCTTCGTCAACGCCCACATAGGGCGATTCAAGCTCTTCTTCTTCTTT
TCGACCGCAGGCCCCACATCAGCATCAAGGTCATCCTCGTCATCGTTGTTGCTGCGAACAGCCTCGCGCATCTTAGCTTCACGCTGCGAAAACCGCTCTC
GACGCATTTGAGCAGCTTCTTCATCTTCAGCGAGCTCGTCCTGCAATCGAGATCGCTCTTTCTGCAAGTCGTGAAGCCACTTCTTGTGCTTTGACAGAGC
TGTGTTCTTTTTGTCGCGTCGAATACCATGCTGCGAGACAAAAATCATGAGTCCACACTCAGAAAATGTACTAACTTGTAGTAGCATTAAACGCACTGCA
GGCTCGCTGAGAATTGGCACGTTCAGGCCGAGAGGCTCGCCGGGGTTACCCGCCAGAAACGCCGCCTTGCTGCTGTCGACCACATTGTTGTTAGTCTTGG
CCCCGTATCGGTTCTCCTTTGCCAACGCTACACCAGCAACAAAACTACATCGTCAGAGTCGCAGCTTTCACGTTCCTTTACGAATCAAGCCACTCACTGC
TCGAGACCCCGTTGAACGGACGATTGCAGAGCATGACGCCCTTATAGTTGCCGATGCTCACAGCCGACGTCGATACGCCCGTCATG