Description :
From Genome Similarity Track
Location :
Scaffold_122:40114- 44562
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_122-snap-gene-0.23Serine/threonine-protein phosphatase
Pytir_DAOMBR486maker-pir_contig_122-fgenesh-gene-0.5ATP-binding cassette sub-family F member 2

Sequence
4448 bases(100 bases per row)
TGAATCTCGACCATCACCTTCACCATGACCAGAAGCAAAGGGAAATGGCGCTCCTGTTCCATGGAACCGCGGCTCGCGACCACGTCTCAAGTCCTGAACG
GCGCAGTTCATCGGGTGCTCATGCCAAGTGCTACCGCCAGTCATGCTACGAGCGCGAGCAGCACACCGCGCGAGAGCTGCAGGTGCGTTGGCACAACGTC
TCGCTATGTCTTCTTGTTTACTGTTGCTTGGGATGCGTAACTGAGGAGTACAATCGTGATATCGCAAACTGTAGAAACTCCGCGACTCGTTTGGTGCGTT
GAAGCTCGAAAAGGACAAGGAAATTGCATTTCTGAGAGACCAGCTCGCAGCGTACACATCCATGTCAAAGTCTCCGATGCGCGTTGCAGGAGCTGGAACC
ATGATGCTGCCATCGCACATTTCAGTTGGTGTGCAGACCGCCTCCGGCTCGAGTCCCATGCACACTCCTACGGTTCACTCTATTGCTCAATCGGTTTTCT
CTGTGACCAGCAATGGTGTTGTGCGCACTGTGCGCCTAGACCGTCAAGCGAGCCTCAAGTCTGCTCGAGTGCTGGCAACTATGCCTCGTGATCAAGCCAA
AGGAGTTGCCGACCGCGTCGCAGCAGCTTTCGCGGGCCCAGCGCTCGCGCTTCCATACCTCCATTCGATTCAATTCGGCGCGGATTTAGTGGAACTAAGC
GCTCAAGTCTGCGCGATGCTGGAATCTGAAGCGCGGTGCCTCAGTATCCCAAGTCCAGTGTACGTGCTCGGTGACATTCATGGAAATTATACCGACCTTC
GCTTCTTCGCTGACAACATGTGGCCCATGGGCATGGGACTCACGCCAGGCAGTTTTCTGTTTCTCGGCGACTATGTCGATCGCGGGCAATCTTCACTGGA
GTGCGTCGCGTATTTATTTACACAAAAGCTTCTGCACCCGAAGAAGCTCTTCCTTATCCGCGGCAACCATGAAACACGTGCGATCAACGGACTCGAGGCG
CATTACGGATCGGGATGCTTCCTGGCTCAATGCAAAGCCCGCTTTGGGAACGAAGAAGGCTACATCGTGTGGCACCAGATTAACCACGCCTTCGACCGAT
TGCCACTCGCCGCAGTGATCGACAACGACATCTTTTGCGTACACGGAGGCGTCCCGCGTCCAATTGGAAGTGAGAGAACACTCGAGTTGATCCAGAAGAT
CCCGCACACGGCGCTTCTCGACGTGCTGGACGCAAAATACTACGAATTGAATGCGCAGATGTCGATGGTCTCCGACATGCTGTGGGGCGATCCAGCGTCT
GAAGAGAAAGAGCCGTCGATGGACAGCAAAGGCTTTGGGAAAAGCTTGCGCGGTGGAGTCGCGGTCAGCTTTGGAGAGAAAGCAATCGAGAACTTCTTGC
AACAACACAAGTTTTCGCGGATTCTACGCGCTCATGAAGCCAAGATGGACGGTATCGCAGTCAGTAAAAGCGCGCGCGTAATTACTATTTTCTCCACCTC
GAAAGACCACGGCTTGGGAGAAGACGCAAAATGCGGCTGCCTGCTGATTGACCACGGCAAGATCAGCGCGATCAATCGCTCGCCTCAAGTTCCGAAGAAT
CCGCAATTGCAGCGACGCCGCAGCATGAGTTTTCAGACCGAAGCGCATAATGGTAGTGCACCAATGGGGTCACCTTTAAGAGTTGGACATGAATTGAACA
GCTCCGGGATCGTAGGAAGTACCGGCACGGGGATCGGACGTCCTCGGAGCAATTTCCAGGGCTCCATCTTGAGTGACGTCTTGTCGAATGCCCAAGACGA
CGATGGTGGAACTGCCGCGCGTGCTGCTCGAGCCACATCCATGGAGGCAAATGCGAATGATGGTGGCTCTGACTCAACAGACGATGAAGACGATCAGTCG
CCACCGCAGCTACCACGGCGACCATGCACTCGCGTGATCGCGCGACTCAGCAACACAGCGGAAAGAGCGAGATCTGCAATCGCATCTAGTGTGGCAGTGC
TTGCCTTGCCATCCGGGACCCCAAGGTCAGCAAGCGACCACGTGGAAGATGAGGAAGGCAACAACCAAAACGACGATTTCTAAAGGCACAAATGAACATG
CACACTCATTCACATCGCATCTGCCAGAGCTCTCGTGAAGAACAGAACCCCATCAATTAAACACGACATGGTTCAAGGTAGATGTAACCTCTGAAACAAG
GTGTATGCGCACAACACAAAAAAATATGGCATGATACACAATGTAGGCAATCAATCGGTTGCCACTGTAGCCGCCCATGACGTCCACGTACATACCTCAC
ACGATCTTCCGATCCTGGATCAACAGTGCAGATAGAGCAAGCGTCGCCTCATGGAGGCGAGTAGCACTCGAGAGCTGCCGCTAGAAGAAGAACATGGTGC
AGTGGCGCTCTCCCCAGCGCCGTCAATGCTATTTCACTAATGGAGCAGCACGTGAACGACGACGACGCTTCACAACGACACCACACACAGATCGCATACG
ACAGCCAGTATGGCAGGAANNNNNNNNNNNNNNNNNNNNNNNNNNACCCTGCATCTAGACTAGCTCTCGTATCCTCCATTGGCTCTCATGGCTGCGGAGG
AACGTTCTGTCTCGAGCTGCATACATCTGCGACGCTGAAGATTCTCCCAACGAGGAGACCCATGACGCGCACGCACGCACGCACGTTGGACGACAAGAAA
GGCAGCCATCATACGTTGGTTCATTTCGCATACGATCCGCAGCCCACCCCAAAAACCAACCCACCAGCACAGGAAACGTTTTGTTTGTTTCGAGAGAGCC
AATCGTTTCGCGTTTCGCCCTGTCGCACGTTGTGTTCGCCGGGGTATGTTGTCTTACAGGTTCATCAAATCAGAAAATGTGTGCTTTATTCAATGTAACA
ACCGCATTTGAGAATTTTCTGAAGATTGTATCTTCAAGGGTATCTATTTTCGCAGGATTTAAGATCACCTGCCAAAACTTGATTGGTGGAGGAGCTTTAT
TCGAGGGGGGTTGCGAGATCGAGATTGGGGAGACTCTGTCGTCGTTGCCGCCAAGCAATTGGCACCCAAGCATTCTCGGAAAGCCAGCTAAAGCAGCAGC
AGCAGCTCCGCTCCCCCCAGACCCGTCCATCCACGATGCCGCCTCGCGCCAAGAAGGAGCCGAAGGAGAAGAAGGACCGCAAGGAGAAGAAGGTGAGCAA
GAAGGCCGCCGCTGAGGAGAAGAAGAAGGCCGACAATGAAGCCGCGCTGCAGAACATGTCGCTCGCCGACCGTCTCGCTGAAGAGGGCATCATTGCCACG
TGCTCGCACAACGCGCGCTCGCTGCACAAGAACTTCAAGGACATCAACGTGCTCAACTTCTCGATTACGTACTTTGGCAAGGTGCTCATGGAGGAGTGCG
ATATCTCGCTCAACTACGGCCGTCGCTACGGTCTCATCGGTCGCAACGGCTCGGGTAAGTCCACGTTCATGAACGTGCTCGGCGCGCGCGGCATCCCGAT
CCCAGACAGCATCGATATCTACCACTTGAAGCACGAAATCGAGGCGAGCGACATGACCGCGCTTGAGGCCGTGCTCTCGGTCGACGAGGAGCGTGGCAAG
CTGCAGGCGGAGGCCGACCTCTTGTCCGAGCGCATGACTGACGAGGGTCTGCCAGAGGAAGAGAGCGAGTCGATCTCGGAGCGTCTGACGGACCTTTACG
AGCGCCTCGATGAGCTCGATGCTGACACCGCCGAGCTGCGCGCGCGCAGCATTCTCGCGGGTCTGACGTTCAGTGACGCGATGATGGCCAAGAAGACCCG
CGAGTTCTCGGGTGGTTGGCGTATGCGTATCGCGCTCGCGCGTGCGCTGTTCATCCAGCCAACGCTGTTGTTGTTGGATGAGCCGACGAACCACTTGGAC
ATGGAGGCCGTGGTGTGGCTCGAGGACTACCTGTCGAAGTGGAACAAGATCTTGCTTATGATTTCGCACTCGCAGGAGTTCATGAATGAAGTGTGTACGA
ACATCATCGACCTCACGGGCAAGAAGCTGGTGTACTACGCCGGTAACTACGACTCGTACGTGAAGATTAAGGCCGAGAAGGAGGAGAACCAGATGAAGCG
ATACAACTGGGAGCAGGACCAGATCAAGCACATGAAGGACTACATTGCCCGTTTCGGTCACGGTTCCGCCAAGCTCGCGCGTCAGGCGCAGAGTAAGGAG
AAGACGCTCGAGAAGATGGTGCGTGAAGGCCTGACTGAGAGGGTCGCGCATGAAATCATTGGCGACTTCAAGTTTCCGAACCCGGAGCCGATCCCACCGC
CGGTGCTCATGTTCCAGAACGTGGCGTTCGGCTACCCTGGCCAACCATTGCTGTACAGTGACGTTGAGATGGGTCTCGACCTGGACTCGCGAGTCGCGCT
TGTGGGTGCCAACGGTACGGGCAAGACCACGCTGCTCAAGCTGATCAC