Description :
From Genome Similarity Track
Location :
contig_26:401104- 407231
Transcript NameFunction/comments
g5488.t1hypothetical protein

Sequence
6127 bases(100 bases per row)
CAGTAGATCGTTTTCGAGCTGCAACAACTGGATCTGGTAGCCGTTGAACTCTTGCTGGAGCTGGCGCTTTTGCGTCTCCAAGTCGGGCTGCTCCAGGTTG
ACGACGTTCGCAAGTAGTTGGTCCTCGAGCCCTTTCTCCGTCACGCTAAAGTCGATGAGCGTGCAGTACGCCAATATTTCAGGTCGGTAGTGTGGGTTTG
GCAGCTTTGTGTGCAGGAACAAGCGGAAGCGCGGGTCCACCTCAATCTCCTCCGCTGCAAACTGCAAGAACCAATTGCGCCCCTTCTTGTAAATCTGCCG
CATAATGACGGGCTCCAAAGACGCATCGATCGCCTCGCCTAGGTTTTCCAGAATGACGCTCTGTCCGCTGGTAATCGCGATTTTCAACGTGGTCGTCCAG
TTCTTTTGAGCAGGCTGTAGGATGACCAGAGACTGCCCTGCCGACTCTTGCTCATCGCGGCGTTCGGTTCCATTCTGTTTCTTGTGTCGGAAGTCGCGAG
CACGCAGCCAAATGATGCCTTGCAGTTGGGGGTCTACAAGGAGCGGCCAACGCTGACAAGACGTAATAATGCACCCGTTCTCGATTGAGATACGATCCGC
AGGCAGCCTTCGTTCATCCATTGAGCCAGATCGCCTACTGTCGCTTAGCACATCAAGCGGGTCGACGCCCACGGTGGGTGACGGTGCAGGCGATGAAGCT
TGTTCAGGTGATCCTTCCGTATCGGTGGCCATCTCCCCGTTCTCACTAGTGTCGACTCCGCTTCCGCTACTGGCGCTGAGGTCTGCTTGGCTTCCTAGTG
TGATTGGGATCTCCCGGGTCACGATGTCTGGTAGCCAGGTGTGTTTCCACAGCTGAGCACGGAAGCTCGCGTTGAATGCGCCAATGTAGCTGACAAATCC
CGCCGCAAGCAGCGAATCGCCGATCAGTGAACTCTCACCAGCTCGTAAGACATCGATCTCATGACCCCATCTCTCATTCTCCGAAGCGAGCCCATTCACC
AGCCGCTCCGCCAGCGATAGTCGCTCCTGACAAGCCTGTGCCTCAGCCTCGACTTTAGCCTTCTCATTCGTAGCGTCTCGGAATGAAGCTTGTAGCGCGT
TAAGCTGGCTTTCTACCTCCGCCACCAACTTCTGCACTGCGGCCAGCTCGCTATCCGCCTCTGCCTTAGTTTGACGTGCTTTCTCAAGGGTGTCCATCAG
CGGCTTGACGCGCACGAATACCTGATGAAACGAGATGATGTTGACAACCCACACGCACAGGTTTGCAGCAGCCAAGGATTTGCTCTTCATCTTCTCGTAG
TTAAAGTTCGGGTCTTCCTGGATCAGGGGCTCGACACGTGCCACGACTTCCAGGGGGATATTCTCCTTATCATATTGCTCCAGAGATTGCTTAAAGACGT
CCACTTTGGCCATCATCTTCTTGGCGTTATCCCAGCTGAAGTTCTTGGTTTCTTTCTTCACCATCATTAGAACGGCTGCCGTCACCTTCTCCACCCCAGC
AGGAGGTTTGCCCATCGACTTGAGCTCCGTAAGAGATGCCTTGTTGAGGCAATTCACAGCTTGCTGAGCCGCATCCAAGGCTGGTTTGGCAATCGCCAGC
TCGACGGAAGCCTGTCCTTCAATTTGTGATGCGATTTCTGCGGCCTGAGTAGCCTTCGCACGCTCTTCGTCAGCACGACGCTGCTTCACTTCAGCATCTC
CACGTTGCTTGCCCATTTGCTCGAGCAAAAGCTCAGTCGCTCTCTTTCGCTCCTCCACTTTCTTCATCGTCATCCTCAGCTCGTCTTGGAGTCCTGCAAC
ATCGAGCGACGTCTTCTTGAGTGTTGCCAGACCAACTTCTAAGCGCTTGATCTTCAGTGTTTGAGATGAACGCTTTGCTTCCAAGAGCGACTTGTAGAAA
CGGATGAGCTCCAAGAACGACGTCGGTGTCACGTAGTTGTGGCGCCCGTAGCTCTTGGTATACATCGTACAGGCTATAGTGACTGACATGTGCATCTCAG
CCATGTGGTGGCAAACGTTTTCCTGAATTGCACGCGTAGACAGCTCCACATCCTGAAGGAAATTGAGTGACACATCCACTAGCGCTTCTTTCGGCCACGG
GTGGAACCAATTCATAGTGCAGCAGCTGATCAGCGAAGGGAAATTCCTGCAGCGAGTTCGCAGATCACCACCCACCGGTGAAAAGGCTAAGATGAGATGC
AAGTTCATGCGCACACGCTCATAAAAGAACTCTTGAAGCTGCTCCTTTGTGTCGGGGATGCCGCGTGCCTTCGCTTCCATCCGCAAAGACCCGGCCATTG
ACTCCATTTCTTCGCTGGAAAACAAATCCGCAATGTAACCAGACGTCAACACGTCGCTCAGCGGAACCAGAAAGCGGTTGTCAATGATCTGAGAGTCTGT
GAGTAGCAGCACAATTGGCTTGGCAGGCCGGATGCCAGCTTTGCGGTAGACGTCTTTTAGATCTTCCTTCAGCTCGCTCATCCCGTAGGTTGGGGACGCA
CTTGTAGTCAATGACACCAAACCGTATCCGCAGATAAACGTTGCCAAGCGTGAGAGCGACTGCTTTCCTGACCCGCCAACACCGATCAGCAGCGCGTTCC
CGTGAGGGTTTGCCAGAATGCGAACGATTCGCGTCACGTGTTCCAACGCTTGGTCGAACAGCACAAGACTCATTACAGGATGCGTCTCGTTGTACTCAGC
GAGTTTCCGCTCCAGGCAACTAGTGAGTTGCGCTTTCTCAACGACAGGGACGTAACTGAGAGGACTACCTCCATACTCGCTGTCCATGGACATTGACCCG
GAGGGTGCAGCGCCCAAGAAGTTCACACAAATGAGGGGCGCAGCGAAGACCTCTCCTTGGTCCTCTTCAAAGTTCTTCTTCGTCTGCTCTACAGCCATCT
CTGCGAATCGTTGAATCTCGCTTGGCGAGCTCATGCGGTCGCTGAAAACACGGAAGCACTCGTGCATCCAAAGACGACAAAACTGGAGCGAGTTGTTTAG
ATACGCTTCAGGCCGTGCCATAAAGATGCCTTGAAACAGCGAGCTTAACTCGCGCATACTGAACACGTAGTGGAACTTCGTGGCAGTCGGGAGGAAGTTC
GCACGCACCTCAGAGTACAAGTCAATGGTTGCAGTGATGATACCAGGGGACAGCTTCTTGATCTTCTCAGCAAAGTTTGTCAGGTGCTGGTTTAGTAGGG
TGGAGTAAATGGTCGTGAGATCTTGCTTGGACGGCATGCTGATGCACAACGTCGAGAAATGGCGGTGAAGACGAGGATTAACCGTAAACGACCCGGCCTT
GTTGTTCATGCAGGCAAGAAATTGAACGTCCTGGATAATCTTCTTGGACGAGAGATCATGGCGATCGTACCATGAGTTGTAGTCCATGTACTGCCGCAGC
AGCGCAAGTGCAGTCTGAGTGCCAAACTCTTCGACGAACGGCATGTTGAGATCATCCAGGAAATAGATGAGTTTGCGGTTGTAAAGCGGACCAAACACAC
GGCCTGACCTTTTCTCGAGAAATTGCTCGAGACGACCTTGCAGTTCTCGAGCGTCCATGTAGTGATGCATACTCACGTACGCGAAGGCAACATCATCTTC
CAGTCCCTTCATGTGCTCGTGGACCAACGACGACTTGCCCGAGCCGCTGGAACCGACAAGAATTGTCGGGTTCCTCTTTCGCAACAGCAAGTCAATGATG
GAGTGCACACGGGTAGACTCCATGGTGGGGATAACAAGCGCATGAAAGGGGGTGTCGCCAACCGCTGTGTGCGCTGGTACCTTGTCGCCCCAGTAAACCA
GCTCATTCCGTGTGATGTCGTAGTAAAAATCGAACATGTTTGCGTTGCCAGTCGCCAGCATTGCTGCCATATTCGTGTCAGCACCTCCTTGAGTTAAGGG
ATACGAGGTCGATCCACTGTTAGTTGATACAGCGGCGAATTTGTACTTGGCGATGGCCTTGAAGTGCGTGGAGAACGCGATACGATCATCAGTGCCCTTA
TCGCTCGCGAGCGCACCCCAAACGCCCACATTGCACAGTGACAAACGCATTCTCTAGCACTTCAGGGGTTTTCTCGTGCTCGCCAACGGAGCTCAGTAAA
CCGTCCAACAAACGGCACAACATCTCCACCATCGCAATAGGGACTACTGGTACAATCGTCTCGGCCTTAGTCTCATCAAGTGCCAAAAACATAGAGTCCA
TGTACTTCTGGAAGAGCCCGGGAAGGATACCCGCCTCAGCACCGCTGTCACGCTGCTGCAACCAGGATTCAACAGCAGGATACCAACCGATATGGCCTTC
GTCTACGTAGATGATGCCAGCTCGAGACACGGTGGCTGGTGTTGCGTTCACAAGCGACGAGATCTCAAATACGAGTCGCATCGACTTTGTCAATGGAATG
CGCTCGTTCGATACGAGCGTGAGAACCTTGTTGTCGTCCATCACAGTGTTCATGCTTTCGATCCAGACTGCATCGATGTCGCCGTCCAAGACTACCCACT
TGTACGTTTGAGATTCGCTAAACGGCGCCGCATTCTTGGACATGTTTCGCATGATAGCCGATAGAACGCCGTCTTTCCAGTCATTGTCAAGAGTCATATA
GCCGTAGAGTTCATCTGCTGTGATGGCTTTCGGGTTCACGCTCTCGAAAACGGTCAGGTGCTTAGCCAACGCATTCCCTTGCTCATCAGCGTTGTGACAG
GCCGCTAGTGTGCTCCAGATTGCACTTTTCCCGCATCCTGCTGGACCGATCAGCATCACACTGTGACGCACCTTGAGGACGTCTTCGAACTCCATCATTT
TCTTCAGAAACCCATCTTCCGGCTGAAGCTTCTTCTGCGCGCACACACGAGCACACTTGGTCTGTAGAGTGTCGCTCTTTAGGTGCGGGAGCTCTTGGTT
AGGGAAAAGGTCTCGGAGCAAGCCCATGAACACTGGGTAGTCTGGAGGCAGGATCCGCGGCGTGTTGAAGTCTCGAAGCACTTGCATCAGCACGGTCTCT
TCTGATAAGGTTGAGTGCGCACGACGCAGACTACCGGCGACAAGAAGCACCGACTTCACCGAGCGTAAGCCCCAGTCGTAATGCTTCTGCTTCGACAGCA
GCTCGCTGCTGAGATCGTAAAGTGTGACAAACTTAACTGAGAGCGTACGCGCCTTCAAGAACCCCTCCGCCATGAGCATGTTTTCACAAATGGGCTGCAG
GTCAGGTTTGATCATGGCACACGAACGAAACAGCGCCTTCAGATTCTCCGGTAATTCCGCACGTCCGGCGTAGCCCGGGTTCATTGTGATGAAGAACCCT
ACTGTCGGCACTAGTGCGATGGTTTTCCCAAAGAACTCGCAATTGCCCGTCCGTGGCATTGCTATGGGCTGCTGAGCGCTTCCCTCTCCTGTAGAGGAGC
CAACCTCACCATTACCAGTTGACGGGCCCCGGTTTGTTGCGGCTACCAGCAGCGTCGTAGCATCCAGCACAGTCTTCACTTGCGTTGCTACCACGGACAG
CACCTCGACTGAGATGCGGTTAAATTCGTCAAAAGCACCCCCACGCTCCAGTCTGAGCTAGTCCACGAAAAATGTTTGCCATCGTCAAGTAGTTCATCTG
GTCACTGCAGTTGAAAACGTAGCACTGGAGTCCCATTCCTCGAGCAAGATCCTTTGTCGTCTCGGTCTTTCCTGTACCGGCAGGACCCGCTGGAGCTCCA
CCTAGACACAGACGGAGCGCGGTTGTAAGGGTGACGTAGCAGCGATCGGTGAGCGGGGTGATCACCAAACGTCCACAGTTGCCAACGTACTCATAGCTGT
AAAACGAGCGGAAGTCACAAATCTTAATGTGCACCTCCTTCTTCTGGCCTGTGCTCGTCACGACAGGCGTCGAGTAGTAGCGAAGTTGCGATTGCCACTG
AAAGTCCAGTGCGCTTGAAACCTTCTTCGTGATGAGGGATTGTACCACATCACGCGCATGAACGTCAACAGTGATCAGGGTGATGATCTTCTGGCGGTCG
AGTGCTCCAAGATGTCCCTGAACCAGCTTTATCAGCTCTTCCAACCGCACAGTCGACACGTCGTAGTATTTCTTGATGGCATCCTCGGTGCCATTTTCAA
ACTCCTCTAGCGCGCTTTCAACCTCTT