Description :
From Genome Similarity Track
Location :
Scaffold_191:4011- 6720
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_191-abinit-gene-0.45Deoxycytidylate deaminase
Pytir_DAOMBR486maker-pir_contig_191-fgenesh-gene-0.1Secretory protein OPEL

Sequence
2709 bases(100 bases per row)
TCGGAGCTCAAAGTGGACTACCGGTGGCCATTGCGCGCAAGCGAAGAGCTCCAAGAGCGCGCGTTAAACCTCACGGTCTCTTCTAGAAACGCGCTCCTCA
ACAGCATGCGCAAGATCGATGGTGACGCGTTCCTTACACTCCTGGTCGACGTCTGGACCGAGCGATCGAAGGCGATCTGCGTGCTGCTGGAAACAGCGAC
GGACGAAGAGGAAGCCAAGAGCGATCGAACATTGCAACAGCAACAGCAGGCGCAGAACGCACGAGCCAAGGTGCTGCCGCTCTTGGACCGCGAACTCCAA
GTGTTTGACGAGCTTACCGACGAATTCTGGAACGCCGAGGTGCCCTGGACGTCCAGGGGTGTGCAGCGCAAGCTCTCGCCGATCGCGCACATTCGGCCAC
TCGAGGAGCTCAAAGAGCTCTACCGCAGCCATTTACAGAATCTGGACGACTCCCGGAAGAGCTGGGACTGGCTCACCCACTGGCGCTGGGAGACCGAGTG
GGAGTGGGGCGTGCTGCGCATCCAGGACAGCAGCAGCAGCTCCAGAGCGTCAGGGCTGTAGAGCGAGCGCCGTCGTGTGTCAACTTAATCATTACGCTGA
CTAACAGACAGACAGACTCGCTGAAGAGCAGCTATTATAGTGTCACTGAATGTCTCACTCGCTATCTCTCGATGTTAGAACGAAGGATATGACACGCACG
GAAAAAGATCGCAACGGCACGCGACTAACGCTAATCGAATCAGACTCGGATGTATGCAGCCATGAGGAGGAAGGAGCGGACACCATGCGTGCAATACAGC
CACGCCAATATGTGCGGTACGTGCTGCATATGAGCAGCGCGTGTGGCGCATATCGGTGGTACATGCAGACCATGCCGCTTCTGCGGAGTGCTATAGTGAT
CCATGACGACGCTGTCATTTCCACCGTTGCCGCTATCACTCAGGGCAGGCAGGCTCTGGCTTCAGTGTGTGAAGGAAATGTATCCATTTCCGTATCAAAC
TTTTCTACCAATAAAATTGCTTGTATAAAAGATGTGGCTGGGTTTTAGCCAATGAAAAAGTGAATCCCCTCAAAACGAGTCAGTTGCGAAAAAAGTCGGT
GATTTTTGTGGAAGTGGCTTTTCGAAATGACTTGGGATTTGTATGCTCAGGAGGGATTGACAAATATCCAGTCTGTCTGGTGTGTAAATACTTGCAATCA
GCAACCACGCTTCCGAGCTCCCTATGCAAAAATGCGCGTTGTCCACAGTGCAACTCCCAAACTTCTTGCTTACTTCATTATATACCGCCTTTAGAGAGGC
CGTGCACCAGCATCGTCCATGGCAACAGGAGCATTCGGAGTCCGTCGGGAACTGTATGATGGAGAGATGATAGAATGAGTGGCATCGTCGCTGGGTTGTT
GTGTGTTGCTTGTTTCTGTCGTTGCTTTGTTATTTGTCATCAGCAAACGGATTGCTTTACATACTGACGACAGAGGGTTGCCTCCCTCCGATGTTTTTCG
CGCATCAAAAGCGCTCTCTAATATTTACCTTTTGACTTTAATATCTTCTTTCACAAACTTCAACTTATTCATTATATCGAAGCTACCTTTGCATTATTGT
TAACGGAAAATCGAATGCTTGTAGCTATTATATGAGTACATTCCGCGCCAGTTCCAGACCAAGAAAGACAGTTCAGTTCCAATCACCAGATGGCGACGAC
GAGCCTCCCTCGCGCGTGTAGAGACGGCAGGCAGCCACTGCAACGGCCGTACATTACATGTAGAAGCAGACAAACAGACAGTCCACCCTCCCGTCTCCCC
AATCGTTCCTGCCTTCTATACAGGGACTGACCCCCATTGCCCATTGCCATTCTCTCATTCTCTGGTTTCCTCCAGATACCACAAGCCCATCCAGCACCAG
CTCCAGCCGTCTCCCAGTATCACCAGCCCAGCAGCTCATTCATCACTATGAAGGTCTATGGCTTCCTCCGCGCGGCCATGCTCTCGGCCGTGATTCTCGG
TGCCGCCACCTCCGTCGACGCGCGCAAGGCCGGCAAGACGCTCTGCGACGCCGACATCCCGGCCGCGCCAGCGTCCAACCCGGGACTCAAGGGTAGCACG
ATGACCAAGCCAGCGCCAGTGATTCCAGTGATCAAGGGCAAGCTCCCCGTCGTGGCTACGCCAGTGCCAGTCGTGGCTGTCACCCCTGTGGCGCCTGCCC
CAGCTCCTGCTGCGCCACCAGCTGCGCCAGTCAACGCTGGCGGTGCCGGATCGATTCCAGCTCCTGCCGCCCCTGGCAAAGACACTGTGGTGGACGGAGC
CGCNNNNNNNNNNNNNNNNNNNGGTGGGTCCTGCCAAGGAAGAGCCTGCGGCGACCCCTGCTCCAGCTCCAGCGTCGACCCCTGCGGCCGCCACCCCATC
AGGTGCCGCGCAGACCAAGACCGGCACTGTCAAGGCCAAGTTCTCGTACACTGGCAAGGACGCCGGCGGTCCGGGCTTCTATGACATGGTCACGGACTTT
GCGACGTGCGCCAAGACCAAGCAGGCTACGTCGAGCCCAGTGTCCCCACTGGACGACGACGTCACAATTGTGTTCCGCGGTCCAATGAACATCTACAACA
TCGCTGTGTTCGACGGCTCGAGCGGCTCGTGGAACAAGGTGTCGTCCTACGAGAAGGGCGGCGCTGCCAACAACTTGGTGTTCCTCAACAACCGCAACAT
CGACTACAA