Description :
From Genome Similarity Track
Location :
Scaffold_6:4011- 23823
Transcript NameFunction/comments
Phypl_g257hypothetical protein
Phypl_g258hypothetical protein PHYSODRAFT_321807
Phypl_g259myosin-like protein
Phypl_g260conserved hypothetical protein
Phypl_g261phospholipid-transporting ATPase, putative
Phypl_g262hypothetical protein

Sequence
19812 bases(100 bases per row)
TTGGTAATTTAAATTCGAATTACGTGTTGTGTCATTAAATTTCCGAATTACGAGTTATGTCAATAAAAAGGAATTCAATATACTTTAACTGTCATAATAT
CATAATTCGAACATCGAAAATGGCGgcgagcttcacgacgcAGTTGGCTCGTGTGGCAGACCGCTCGCCCCTTTTACTGCATCTAACCACTGCCAGCAAC
AACCCAGACAAAGCGCCGTCATACTCATGCATCATAGTTAAGATCCGTCcaatgctgctgcatttCCTCGTGGACAATCGCTTGTGGGTGAGTGGACGGC
ATGAATTCTGACCATAGCCATTATCTAACCAATGCTGCCATTACCATCACTCTTTCAGTGTGTGATCAAGTCCAAGGTGCCAATTACCGACGTTGCAAGT
TATGGCAGCCATCACtctgaaggtggtgaagctcgtcacaagctgctggtctcCGCTGTAGATGGAAACGTGTGGATCGTGACGTTGCCCCGGCATTTCC
AGCCTGCAGTGGGGGTGGTGACACCTGAGTTGCTGTTGGAacgctcgtccagcgagaGTGATGGTGGATCGGTGCAGTGGTTTTGTCAGTTGCCGGGAGT
GCAGTCGGTGGATCATACTTCAGCAGGGTCGGGACTGACGTCACTCACGCTGATGAGGAGCTTGgtggcgccgtccacgtTAATCGTGAGCACTCGCAGA
AGCCCCGAGTCAAAAttgcagcgccaccagtcgctggagctggatgAGATCGAAGGCGAGCAGTCTACGTGTGCACTTTGTTTGAGTAGTCAAGTGGCAA
GGCATTGTGGGTTGCTGAAGAGTTTGTTTCCGGACATGGTGAAATACGCGGGTGCAGCCGCTGTTTTACAGGGAGATCTGGATGGCCGTGTGCGATTTTC
GTTTGTGCACTATCCGAGTAGGAAGGGAGACGTCGCGAAGGCGTCCGTAGTTCGCAGCCGAACGCTTCTTCGGCTGGGTGAACCTGTTCAGATGATCGTT
CCGTTCTCGTCTTCCGTGGCAGATGACACAATGGTGATACCGCAAGTGTTTGATGCACTACTAGTGCTTGGTGGTCGAGGCAGGATCGGGGTTGTTGGGC
TGGAAAACTGCTGCTCGGTGGAGACTCTTCCTGTGCcattgaagaagctggagcttggGCGCGCAGTACAGTCGTTGGTATTCGTGAGCAGTTTAGCAGC
ATTTGTATTTTGCTCGTGCGGCTCGGCTTTCGTATGTCGCCGCACCGATCTACTTGCGAAAATCCAGTCTGCAGATTCAGAAGCAAACATTGTTGATCAC
AGCGATGATCGCAATATTTCCGCGGAGAAGCTACCTCTTCAACCGGTACGTACCATTGTGTTTCCCACAGTCGCTGGGCTTAAAGCTGTATTAACGAGGA
GTGCGTGAATTTAGGGCATCGTGCGTTTGGCAAGTCATGGCCATGCACGCGGTATGTCGATTCTCTTCACCTCTGGGCGGATTACAACTATCGATGAGAC
AGCGCTTTGCACGATGGTTACCAGTGTGCTGCCATTACCTgggcgagatcgaggccaaggaggacaaTCATCTACTGGAGAACCAGCGAGCGAGTCTCGG
GTTCGCAATCTTCTGCATCGCATCGCGCAAATTTCCACAGAGTCAACTGCTCTGCGCGTCCAGTCGAAGCAATTGGACTATCAGCTCAAAACGTTACACT
CTGCTTTGGAAATTCTTCGAGTtgtggaagcagcaggtTTGTGTGATCGATCGTTTTATCGTTAGTGTATGATCGTCTCATCTGTTCTTTGTTGCTGTAT
CTCAATTCAGGCGTGGAGTCTGTAGTCAAGTGCGCGATGAGAGCCTCATTGGTGATAACTGGACCCTTGTCGGATCGACAGACAGTCAAGCTGGTATGCT
CCTTATTCGTAGATCCCGAAGCTATCGTCTCACCCGACGACTGGTACGTGATAATCATCGTTCATTAGTTGCTCATAGGAAGTACCATTACAAATCCTGA
CACTGCTCTATATTGTTTGTTGCGGGAATAGGTTGCTGTGTCTGTACGTGCGTACTCGTCAGCGCGCAGTCACGACGTACTCCTTTCCGTTGGAGGATAT
AGCAACGCGGGGGGAACAGAGTATCGTCCTTGACCCTGACACACTCACTCAACAAGACCAAGGATCTTTGTGGGTATCGTGCTCGATGGTATTTTGTCCC
TCAGGGCAACCAGGCAACACGCATAGCGAAGTAAACCATGCCAATTCGACGGGAATTAACCAGGAAGATCCGTTGTCGTTTGCAATCCCGCTGCTCCAAG
ACCGAAGGTTTCTGTTCGCACAGCTGAGCCAGCCAATTGAGGAAGAAATCCCAGTCAGTCAAGTTGCCATCCACGCTGCTTTTCGTCAAAATCATGAGCC
ATTCATGCCAGTCGGCAGAGCGAGCACAGAAGGGAAAGATTCTTCGTCTGCACTCTGGGGAGGTGTGCAATGGTTGTCTGCACTGGCTGACCATGCCCAC
AAGAACCCATCGTTCGCAGCTTTGTGGTCCAAAATTGTGCCTTCAGGTGCGGCACCTCTGGCATTatctccaccttcacgcTTCGTGATATCCATACCCT
CATTCTTCGCCACCGAAGgtgaggacgaggatgacgaggacgaggatgaaaATCATGAAAAGGTTCGCGTCGAGAGGATGGTGGCGTTCCTGCGTCATCT
CCTGGATATATCCATTGATGAACTTCCACGTTTGCGCCGTAGCTGCCGTACGCAAAATGGAAAGCTGTGGACGGTACTACGAGCTTTCTCAGGAAGCCTC
ATTCTGCTACGTTTCACGCCGTCAGAAGACCAGCAACGCTCCGTTGATCTCACTATTCAATGTTCCGACGTGGCTGATCTCTCAGCGGTACGTACTGTAG
TCTGCATTGCTAAAGCTCCAATCATCTCTGGGATCCTTACACTAATAATGACAATGATTATCTGCAGATGCGCGCGCTTGTACTGGAGGCGATCAACAAT
TGGAGTGGTGCGGGTCCTCCTGGAATCAGCGAAGAAGACCGCTTTGAAGAGTTAGCGCTGGATATGAGCGAGATGTTGGAACCCATATCCGCTCTTGAAA
ACATCCTGGAGGTTCATACCTTAACCTCTGACTTGTGCTATGCTGGTGCAGTTTGTAAAAAATTGTGTGCGTTGATTTGTTTCACAGGATCTGACCTTGA
AGACGGCCAAAAGTATAGAAGACCCCAACTCGGCTGCTTGTACGGATGAAGTTCTGCGCGCGCTTTCACAGCTGGCGCACCTAGAGACTCAAACGCTCAC
GCTGTACTGGAAGACAAGGTTACATCTCAACAGGACCATCATGTAGGTCCGGAAGTGGACTAAATGTTGAACAGAAAACTATCAGCTACATCAATGTAAA
ACGCTACGACAGGAAGGACACTGCTCGCAAACTACCAGCGATACAATGCTCATCTTGCTGACTGGTTTAGAGTTCATCAGTGGGGAGATGCTGATCACAC
AACGAAGCTTTctcggacggcgacgacacgGAGTAGAGGCGCTACACGTTCGACACATACGAAATTCAACACGAAGCTGTTAGTAGCGATCTTGCCATTG
TCACCAACTCTGCAGCATCTCTCGTAGTACCTCGAAGTAGCGGGGCGCTCGAGTCGGCCACAGCGTGTAGATGAGGGTCAAATAGATGAAGCTATGCACC
GAGGTCGTCATGGCAGCCACTGTCTTCTCGCGCACCCACGGCGACAAGAAGGATGCGATGAGCACGATGATAGGCAGGGCTACGAAAAACACCGAGAACA
GGCAGCACATCTGAACCTAGGGGGTGAGCATCAGACACCCACAAGTTCCCAGCAGCTAGGAGAACTTACTCGTAGGAAGAAGTACCGCTTTGTCGAGGTT
TTCTCGTAGGAGCGAGTCTCCAAGATGGTGTTGATAAACCACCCAAGCACGCACATCTGCAGCACGCAAATGCCAAGCCCAGGCCATGAATCGTAGATGT
ACAGCGTCGATGCTGGGTCGAGCCATACAAGGTACCACATCGCCATGGACAGGTACAGCACGAGAATGGTCAGTATGACGCACGAAAGCTTGATCTGGCC
GTCCAGTGCGACGCTGTTGATTGTCCATCCTTTCGCGATCACCATGGCAAGTAGCAAGGTGCCCACGCGGACAAATACTTCTGTGATCTTGGCCGCGTAC
TTGAAGAACggcacgccgacgccgtTGAACTGGTACATGGTGAAgtggacgaagagcagcgcgttgcACAGGAAGAAAaacagcaccaccagcatcaaAA
TCCGCATGATCGGGTGGAACGACTCGCTCTTCCTCATGCCCCGCACTGCCACAatctgcgccgccgctgccgcccccGCAACTGCCGCCATGACGGCATA
GATCGTCGGCATCCCTTGTTGCTGCACGGGAAGTTCACTCCCACCCCCCTGCGTCATGTGGATGTTGAACCACGATGCGAAATAGTATTTGCGGAAGTTG
GTCTCCGTGATCTCCGCGAACGAAGGTTTGTACTTGTCTCCTCCCGGGacgcagcgagcgagcgccaCGTACCAGAATCTCGGGCGTAGATGTTCGTGGA
TGTCCACGCTGAAGGTGAAGGGGGTCACGTGGTGGCTATTGGTGGCGGTCACGTTGAAGACGCCCTTGGTGTGCTGGGCGGAGACCTTGCAGTAGCAGTC
GCAGGAGCTGTCGGTCATGACGAAGTTCCAGAAcagcgcctcgtcgtcgtagatGGCCACTTGCAGGCCGTCCACGTCCGTCTCGATCTCGCCCGCGATG
CGCTGGCGGCAGGCAACACAGACACCGTTAGTGGTATATAGTAAAAGAGTGCGTACTAATAAGTGTTGAAGGGTTTAGTCGTACCCccgcgacgtcgtcg
agagTGGGCGtccaggagaagcagaacTTGCCGATGTACTGGAACTGCCGCCCCACGGTGTAGCCCGCGAAGATGCTAGCGTGGgtcacggacagcagcg
ccacgaggctGAGCACTAGCAGCAGGAATGGCATCGTTTGTTTCTCTGGTGACTACTGGGGACGTAGCGATCTTCCATATGACAACTTCAAGGTTTGGCA
GCGCTGAATCGTTTTCTGCTtggatgtagccatgtgcGGCATAGAGTAGGTTCGGAGAGTTTACGGGTTTgctcgtacatgtagttgtGTCTCGGTGTCA
GGGGAGAGCATTGTCGTGCTCCCTGGGTGGCCTttgccagcgccacgttTGCCAACAGTCAAGAAGCGTCGCGGCTGTCGTGCAGGATATTTTCTAGGCG
TTTAGATTTCGGTACAGCAGCTAGCAGGCTATTCGTGGGTTCGCTCGGGGTGGCTGGCGTTAGCTCGTTATGTGGTGGCGACGGAAGTATCCATTATGGC
AAGCCGAGGCTGTTTACAGCCCAGTGGGTCCCGCCGCAGGCTGCAACGCGCAGGTGGGCTGATGTCAAAGAGCGCGTACGAGACTCCAACAGGCTTTGCC
GCTCGCAACGCTGGTGTCTCctcacagcagcagccgccggAGTTATTGCGACCATGGTAACGGATACCAGCCCCGGTGCTTGGCCAGTGAAGTGGCTTTG
TGCCCGCCCACACATCCCATGCAGCGGCTTCCTCGAACGGAACCTAGCCGTCGATCGAAAAGTGTGGATACACGTACTGTAGCAGCAAACGGGTACTTAA
TGTAGTATCCGGTGTGGCTTCATCTCACGCCCACGCGCAGGTATTTAGCGACACGAGTCTAGGCATCTTGGCAAAGCACAAGCGAGGGCATGCGTTGTCG
CCTTATCGCGTTGGTCTGTTTCAACAGCTGGCTCGCTATACTCGAGTGTTGTATGCCATCCAATAGCGCCGTACAAGAGTTCGGCTTTTGGGAAAGGGGA
AGGGCGCTCGGCCAACTTGACCATCACTTCGATTGGCAGCAGTTGGGGGAGTCAGTTAGCTTTTGTCAACGGTCCAGTATCAGCGCAGCGTCTGGTCGTG
CGCTACAGCGTCGGAGCGGAAAATCTCCTGTGTGTTTCATCGCGTCTGTATCGAGAGGGAGCGTCCGCCGGGCATTGCTCAGAAGCCGCTCTATCGCAAA
CTACGACGAGTTGTGAGGGTTAAAGGAGACGACCGCCAAGTGTCAGGTGTCGAGGCTCGCGCtccctcctcctcttcgtcttaTCCGCCCAGGCGTCCAG
TCTTCCAGGACCCCAGCTCTACAGCTAGCTAGACACAGGCACATCGAGTAGTTGGTCGCGACACGACCGGGAGTGTTggtctcttcttctccagcatgaC
GGTGCGCCgcacggaggagctgcaggagtgGGTCTGTAGCGTCACGGCCGCGCCCAACGACCATGGTGAGCACCTGTCGGTCATGCTGCGCGACGGCCAG
TTGCTGTGTCTGCTGGCCAACGGCGTGGACCCGACGGCCAACCTCAAGGTGAACAAGCTCAACACGGTCTTCCACTCGAAGGCCAACATCCGCCTCTTCC
TTGAGTGGTGCAAGAAGCAGGGCCTGAACGAGGGCGAGATCTTCCAGCcggacgacctgctggacgccggcgccgactTCGGCACCGTACTCGAGACGCT
CTCCATCCTCTTCGACAGGTTCGGCACCATCGGCTACACGGGAGAGTACGAGGAGGACCCGGTTTCGGACGCCGAGTCCATGACGTCCACCGGCAGCTCG
CAAGGCGCGTCACccgtcaagaagacgcacagcaacaacaagctcACGAGCTTCATGAAGGGCGGCTTTCTatcgaggaagaagaaacagtcgagcaaga
aggtggtggacaagTCCCCGCAGGGAacgccgccgtccacgccCCCGCCAGTGTCGCCGCAGGTCGGAGGGGGGATGCTGTCTCCGCCGGGCTCCCCGCC
TGTGACGCCGTTGGAGCCGCCCCCGCACAAGGACACGAGGAGCGACAGTGGAGGCGCGAATGCCAACCGTCtgaacgccttcttgagccaAGTGCCGTCT
TCGCACGGTTCCCCGTTGACGCACATTGAGCGCCCGTCAGGTCCGCCGAAGAAGGCCAACTCGGTGAGGAAGCCCCCGGCACCTAAACCGGCAcccaagc
cgaagccgacTGTAAGGAGACCGCCGTCCCCCAAGCAGCCCCCCAAGTCGCAGCCGACTGGTGGAGACGCCCGCAACAAGTTCGCGGCCTTCATGAAATC
CAACCCTCCTGCAGTCGAGACGACACATGTTTCAGGCCCGTACCCCGGGTCTGGTGGCAAGTCATCGGTCTCTCCCACTGCGGACAAGACGCCTGTTGTG
TCCCCACCGAAGTCTGCACCTGTCCGAGGTCGTGGCACATCAAGCGATCAGTTCGCGCAACGCAAGGCGGTCTTCACTCACGGCAACAGCAGTCCCAAGC
CGGACGTGCCCGTCCCCGCTCCGTCGAAGCCCACCGTCAACACGGGAGCTGGTAACAAGTTGAACAGCTTCATGAAGCAGCAGTCGTCCGCTTCACCCGA
TTCCTCGTCGAAGCCCCGCTCGCAGAGCAAGCTGGCGGCCTTCCTGGCGACAACGAACGCGATTCCTTCAATTgccacggccgcctcgcCGAAACCGACG
TTTGGTTCGTTTAATCCGTTGAAAAACTCCCCGGCTAGTGGTCGATCGGCTCCGAAGCCTGCGTTCAatgcaccagcagcctcggcaCCGACGTCGTTCA
AGCCGCGCAACATGATTGAGCGCTCCACAGGTCGCGGCAACTACATCCGCAAGCGTCAGACGTACCGGGTGCCTCCTAAGCGTCGCCGCAACAACTTCAG
CTTGGAAAAGAAGCGTCAGGATTTCATgaacgagcagctggagattaaggaggagcagctccgtcagcaagctgcaggtgccaGCAACAAGCAGAACTTG
ATTGTGCCTGGTGTGCAGTGCTACATTCCTGACAAGGAGGAAGTGTGGCTACTTTCCGAAATTGTGGACTACAACGACCGCCGAAAAGAGGTGACCATCA
CGGCTTTCTTGGATTCGGGTGATtcggagcagcgcgtcgtggatCTCAAGAACCCGGACGTCATTCGGGCGGTTGCTGGACCTACGGCAACTGAGGTGGA
GTCGCTTCCGGTTGCAATCCTTCACGACAACCCGGAGGGCGTCGAGGACATGCGCCTGCTCCGATACTTGAACGAGCCTTCGATTCTATTCAACTTGAAG
CAGCGATTTGCCGCCTCAAAGCCCTACACGTACACCAACGACATTGTGATCGCTGTCAACCCGTACAAGTGGATTGATAACCTCTACGGTGACCATTTGC
ACGAGCAGTACCTGAAGAAGCCGCGTGACTCGCTGCCTCCTCACGTGtactcgacgtcgacggctgCTTACAAGCACATGAAGACGAACGAGACGAACCA
AAGTATCCTGGTGAGTGGTGAGTCTGGTGCCGGTAAGACGGAAACGACCAAGATCGTGATGAAccacttggccagcgtggctGGTGGCCGCAAGGACAAG
ACCATCGCTAAGGTCATTGACGTGAACCCGCTTCTTGAGTCATTTGGTAACGCTAAGACGACGCGAAATGACAACAGTTCGCGTTTCGGCAAGTtcacgc
agctgcagttcgacgGCCAAGGCAAGCTGATCGGTGCCAAGTGCGAGACGTACTTGCTGGAGAAGTCACGTGTGGTGTCTATTGCTGAGGGCGAACGCAA
CTACCACATTTTCTACCAGCTCTTGGCTGGTCTCCCCAGTCGCGAGCGTAAGGAGTTTGGTCTTGACCCTGACTGCCTGTACCAGTATGCTGGATCACTT
GCGGAGATGCAGATCCCTGGTCTAGATGATGCCAAGTGGTTTGCAAGCACGCAGAAGTCGCTGTCCACCATTGGTCTGGATGCTGGCGCGCAGAAGACGC
TTTTCAAGATCCTGGCTGGTGTGCTGTTGCTTGGTGAGGTGATGTTCGACAAGAGTGGAGAGAACGGATCGCGAATTTCGAGCGGTTCTGCGCTGTCGCA
GGTTGCCAAGATGTTCGGTCTTCCGACGACGAGAATCGAGGAAGCACTGTGTAACCGCACGGTCATCACCCGTAACGACAGTGTGACGGTGCCGCTGGCT
CCtgtggaggcggcggagaacCGTGATGCTTTGGCTAAGACCATTTACTCTAAGATGTTCGACTGGATGGTGGTGAAGATCAACGCTGCTATCAGCACCG
ACGAGAGCCGCATCAAGGGCCAGATCGGTGTGCTGGATATCTTTGGTTTCGAGGACTTCGTCCACAACGGATTCGAGCAGTTCTGCATCAACTACGCGAA
CGAGAAGTTGCAGCAGAAGTTCACTACGGACGTGTTCAAGACTGTCGAGGACGAGTACATTCGTGAAGGCTTACAATGGGACCACATCCAGTACCAGGAC
AACCAGGGCATCGTGGAGGTGATCGAGGGTAAGATGGGTATTATCGCCCTGATGAATGACCACCTACGTCAGCCGCGTGACACTGAAGAGGCTCTGGTTA
ACAAAATTCGCACTAACCaccagacgaagaagaacagCGAAGTAAACGAGAGCATTGACTTCCCCAAGGTAAAGCGCACGCAGTTCATCGTCAACCACTA
CGCCGGTCCCGTCACGTACGAGACAGTGGGTTTCATGGAGAAACACCGTGacacgctgcagaaggatCTGCTTGACTTGATCCAGTTGAGTAgcctctcg
ctgctgccggagctcttcgaagacagcgaagcgacgacggagggcGGCAGCGGACGTGGCAAGAAGGGGCCAAAGAGTCTTGGCTCTCAGTTcaagacgt
cgctggcgcagtTGATGGACAACATCAAGACCACCAACACGCACTACGTGCGTTGCATCAAGCCGAACTCGAACAAAAGCCCGACGAAGTTTAACAAGCG
CATGATCGTGGAGCAGTTGCGATCGGCCGGTGTGATCGAAGCCATTCGAATCACGCGCTCCGGTTACCCGAGTCGTCTAACCccgaaggagctggccacg
cgctACGCTATCATGTTCCCGCCGTCCATGCACAGCAAGGAGGTCCGCCGCAcgtgcagcgtcttcatgATGTCGATCGGCCGCAAGTCGCCGCTTGAGT
ACCAAATGGGTAAGACGCTGGTCTACTTCAAGAATGGTgtcatggaggagctggaggccatgaAGTCGGACTTTATGTACTACGAGGCGCGCACCATCCA
GCGTATCGCGCTGGGCTTCTTGGAGCGCCGTCGCCTGCGCAACAAGATCCGTGCTGTCATCGTGTTGCAGTCCTACGCGCGTATGTCGCTGGACTTCAAG
GAGTATCACTTCCAGCGCCGTGCGATCATCAAGATTCAGCGTGGCTGGAGGAGGTACAAGGCTGTCCCCGTTGAGCCCGAGTATAACGACTATGAAGAAG
AGCACAACGGCGGTGGTCAGTgggtggacgagatcgacgacctcgacgacTCGGATGCCGACGAGGGCTTTGGCAACGACCCGGCTTCGGTTCGTGCAGG
ACGCGGCCGATCGATCGCGGACCGCATGGAGTCGTTCAAGGTGGCCCACTCCGGCCGCCGCGGCAGCGTGAAGCGCCTGAACGAGCTCTCGGCTCGCGCC
AAGAGCTTCATGAAGCCGCgcagcggcagtggcagcacttcgagctcgagcggcaTCTCGCTGGAGGATGAGAACTCGATGCTCAAGATCGAGAACCGCA
ACCTGAAGTACGATCTGGAACTGATGCGCGAGCAGTgcatcgagctgcaggccatcATCCTCGAGATCAACAAGAGCCGCAAGCGGTAAAACGGTGTGTG
ACGTCGGGAGCAGTGCAGCTCTACGACCCTCGCTGCGTTCTCAGCCAAGGCCGCAGCCGGAGGTCAACAGTTTTTTTAAGTAAACGCCGCTGGGCGTATA
TCTGTAGCGAAAGTCAAGAACAATTTTCTCTTTCAACATGTGACGACGTTGAGTAGTTTACATTGGTGCGTTGGTGTTGATTGCCTTTGACATCGCCGTC
ATGCAGGTCTCTTCATGCGCGGGAGAGGCCGTCGCCCATCAGCCAGATGGACTCGATTCTTTCGTTGTGAGTCATGGGGACATGAAAACTTTTGTGTGGG
CTTCAGGCTTACATTCCCATCGGAGTTCGGTGTGTTTGCTATACCGGTAGTCTCGAGTTTTATCGAAGAGAAGGTGCCGAGCGCGAGAGCTCGTGGCACT
GCCGATAAGTCGGCGTAAATGTCATTACTGATGCCCGACATCAATCTCCGTCGCGCCAAACGCCACCTCGAGGTTTGTCTTGGATGCATTTTTCATCCGA
GTCTGAGAGTCGTTGACGGTCTTATTCTTGTCCTGCATGACGTGGTGCCGTTATTGTCGCCCGTAGCGCTACTGGCGCCAATTGCTTGGCGGGGACCGAC
CAGGAGAGCGCAGGTGCTTGATATTTCGATCCAAGTCCGTTGCTCAGGCCAAggctgggcgagctgcacTGCCAGAGAATGCCAACCCCGGCGCTGGTGC
CTCTGGAATCAATTCCGTCGAGGTCGCTCCACCGATTCAGAATCTAGAGCCCGACCCGGAAATGGAGGACCCCGCTGCTGACGTTCAAGAGGAACTTGAT
TGTGGATCTCCACCGGtggcgagaagcgcgagctgtAACCAGAAGTCGGAGACcgaaggcgatgacgacggcaAAGAGAAGAATGAGGAGCGTCACGAGG
ACCTGAATCAAGTGCCTGCTCCTGAAGATGCAGTCGACAATCAACCTGCTAGCCCGGACAGCGCTGACGAACTCTCGAGGTCAGCTCCGTCGTCTACGAG
CACAACTGGAACGTCTTCGTCGGTCAGCTCTGTGTTCACAGTGCCATCCTCACAAAGCACAGCCGTTAGTGTCGGCAAGCCGCCGCTGTCTCGTACTCTC
AAGGAGAACCGCTCAAGCTCTTTGCCACCGGAAAATATGCCACCGCCCAAGTACATTTCGCGGGTTCAAGGTCAGTTGTGGATAAGTTATCCCTGCATGG
ATCGAAGCTGTGTTGACTCATGCAATGTTGTGTTCATGTCTTGTGACTAGGCCCGACGCTAGGCTCCATCTTGCAGCGGATCCACCTCAACGACGGAGAC
GTGAGCGAGCTGGACTTCTCGACTCTCGCGCAACGCAACAAACGGTTGGAAGCTGAAGGGTGTGCTCTTGTGGCTCGCTCTCTGTCGACCAACCACACTG
TCCGCAAGCTCATTATTCGAGATCACGCCATCGGAGACAACGGAGCCATCGCTCTCTCGAAAATGCTGTGCAACAACACGACTCTGGAGTATCTCGATTT
GTACGGTAACAACATCGGTGAccgaggagctgaagcatTGGCGCAGGCGCTGTACGGACACGACTCTCTGAAGTTTCTGAGCCTGAGAAGCAACTTGATA
GCggatcgtggagctgaagCGCTAGCTCAGGCCGTTCGTTGCAACTGCACTCTTCAGTCTCTGGAATTGGTTCACAACCGCATCACGAGGGTCGGAGCCC
AGGCGCTACTTGACGCGGTGGACGTGAACACGCACTTGGAGACGTTAAACGTGGATGCAAACGATGTACCGGCCTTTATTGCAAGTCATCTTGCTGCGGT
TTTGGCTCGCAACCGTGCTGAGTCGCTGATACTTGAGTCTCATGCtgcggagaagaaggccgtgaAGATTGTGCGCCGGGCCAGTGGCTTGgacgctgaa
gacgaagacgacagcagcagcgagaaagaagaggaggaaTATAACTGGGAGGATGAGGACTGGgaaggtgacgacggtgACAGCGTGTCCAGCGGCTTCC
TGAGTTGCTCCGGTGTCACAGATATTCCGTTGAGCAGCAGTGGCCTATGGATTTGACAGCGCGTGCTTCAGCACCTACGATAGACGAAGGCACGAAGATA
ATAAAACCAACTGTACTTATGCAGACCCAAAACTCATGTTTCCCCATAGGCCGCGTGAtcagcagaagaagttggcggtgctgccagagatgtcgtcgtc
cagtACTTCGTGGCACTCGAGATCTGCCAAAttcacctccacctccactgTGTCAACCCAACATTGAAGCGGATGGGCTTCGAGGGGTGCGTAAGTCGTA
GTTGCACCTGAATACTCAGAGCCCCACATCTCACGATAGTTTTCCTTGAGATGCTTGTTCAGCTTCCAGTCGATTCTGTCTTCACCATGAAGAGCAGCGT
ACagtccaagctgcttcagcgattCGTCAAACCAATCGTTCTTCGCTATCGGTACTCTGTCAAGTGGAGAGAAAAAAGCTGGGACACGAGGTGGCGGTTG
TTCGTCTGGTTGATATCTCCCGGATGTTCCTGGCGGCAAATAGGAGCTGCCATCTCGCTGTAAATACACTTCTTTACCTTCATTGAAGGAAAATGACCCC
GAGTTTGCATTTCCAGTAGCACCAGACACTCGAGCGACCACGGGCGAAAGTACCGGCGAGATGTCCAAAGTCATCCCGGCGTGCAGACTTTGCCAGTACG
CTAACGGTGGAGAAGCCAAGCGGTGTTCCAGAATGTCTGAGTTCGGGCTCTTAAGACCACGCAAGCTGGCCACCATGTCGCCAAAGAGCGATTCACTGTT
TGTGACACCATTCCACTGCTCCACAAAGGCAGGGCCAGCAAACAGCACACTTGGATCCGTGAAAATGTCGTAGTTGAATCGGACGTACTTTCGTAAGCCT
TTGTCGATAGACTCGGAAGAAGTTTCGAGCGACGTGTCAAGCATGTTGCAGCTTTCCAGCACGGATACAACATCGTACAGTCGGCGGTGCACATCGCTAT
AAAGCGTCTCCGTCGATGAACTGGGCCTCAAAGCGCCAATCAACTTTTTCGCTTCAACGAGACGGCCACTGATAGCGGGTAGCCCCACTCCAACCTGGTA
GTCTTGCTGGAAAAGCAAGCTCAGGAAGCAGACCGTCATGGTCACCAAGCATGGCCACTTCTCACGTGCCGCCTGGTCCTCGAACACTCGCACAAGAGCA
CTATCTTCTTCCACGATGCTGGCCCGCTTGGAACGGCGAGACAGTCGATAGCTCCCCATCACTTGAGCCGAGTTGCTCTTCATCTCCGCCAGatgctgca
ccaccgcagcCCTCCCATAGTACAAAAAGTATCCTCCCTTGGTCCTTCTCGTCTCGCCGCATCGAACCCGCTTGATCACTCCAATGCCTGCAGTCGCAAA
TGTTCTCATATCCACTCCCTCTTCCATGAAATACTACACGCAGCGTAGTATACcttccagcacgtgcagcacgtcgtaGATCCGTCTCTTCCTCGGCACT
ACCGGTACGCAGCGATCATCAGGACAGAGTCCACCACGACGGGAAACACGCAGGTCCTACCCTTCATCTTGTAGATTTCACTCGATGGCACGAAGATCGG
GAACACGGGGTCAGACGCAGAACCCTGCAGGTCCTCGTGCTCCTTAAATAACTGCAGCACGCTCCAGGTTCTGACAGGCCACACAGCTCCACGTCAGCCG
CCTCTCCTCCCATGACATGCTCTTGATGACGTACATCTCCCCCAGGCTCTTGGCAGCCGCGAATTGCTCTTGGATGTTGCTCCATGTGGCTGCTGGTAGG
CCGTCCCCGTGTCGTGTGGGCGCTGGGCTGTCGTGGCGCGAGCGTGGCTGGCGTTTGAGCCGCTTTATAGGCCGCTGAGGGGCACGCTCGACCTTGACGG
TCACCGCCGGGGCGGCGTCTTTCGTCGAGGTGAAGCGCAGTTTGCGTCGGTGGGCGCGCTGGGTCTTCATCGACTTGCACTGGAGCCGGCAAATTCGAAA
ATGAGAAAGAGATCCGCACTTGAAGCGACAATCACTCTGCCACACGTCCGACGTGGTGTCCTTGGGCTAtgcgaccagcacgacgatAGCCATGTCTTCG
TACAGAGGTTGACAATATCGATGTAGCATCGGACTGCGACTTGTTTGGTACTTGTCGGATAGTCCTTTTGTTtgacaagttgaagtggagcGACAGGGCT
TGCGGGCGGAACACCAGCGAAGTGCATGCAGCCATTCACAAGTGAAAAGCAACAAATGGCATTGCACTCGAAAACAGCGGTCCCCTGTCTCTTTAGGTAA
GTTGCAAACCCCGAGGGCAACCAAATTCGTTTCGCCTTTTTGCGTCGCTGAAGTCTCTACTACTTTGTTcttgtgtacatgtagtcatCGCAGCGCTCAC
TCACCAGCGGGTAGTCAGCTTGTCAACAAATTAATTTTAGCTTGGCGATTCATTGCAAAAATAGCTGCTTCATCCAAGAAGCGAAACCCCCTGCCTCCAC
TTCTCACGATGCTTGGCCTCTGCTCTATTCAGGGCCGTGGACCGTTAGTGAGCTTCATTCCAATCTCCTCGCCGCACTTTGTTTAATTGCGCCAGCACTC
ggctctctctctctcagcTTCCTGCTTTTTCTCTGGCTGCGGCTGTGCGTGGCGGAGTGACCCATGGGCGGAGGAACGACGGAGCACGCCGGAGAGTTCC
GCGTGGTCCATCTAAACGATGCACACCGCAACACCGAAGCCGGCTACTGCAACAACTTCATCGTCACGTCCAAGTACACGGTCGCAAGTTTCCTGCCCAA
GTTCCTGTTCGAAAGCTTCCGCAAGCTCTCCAACCTCTACTTCCTCGTCATTTGTATCCTGCAATGCATCCCGGAGATCAGTAACACCAATGGGCAACCT
TCGActttgccgccgctgctgttcatcaTCACGGTTGATGGTGTGTTTGCCGTTCTGGAGGACCACAAGCGTCACCAGGCCGACAACATTGCCAATGCAA
GCCCGACACTTGTACTAGATCGTGAAACGAAGAAATTTAACCAAACCACGTGGGCGGACGTCGTGGTGGGCGATATAGTCAAAGTTGGAAACCGTGGGCT
GGTACCGGCCGACATGCTTGTGCTCGCTGTTAGCGAGATACCGAATCAACCACCGTGCGGTATTTGCTACGTCGAAACCAAGTCTTTGGATGGAGAAACC
AATATGAAAGTCCGTTCCGCAATGGAGTGTACACTTGCTGACATGGGCGCAGCCGACAATTTGGCCAAGATGAAAGGTGTCATTCGTTGTGAGCACCCAA
ACAACGCTATCAACAGTTTTCAGGGGGTATTGGAGCTCGAAGGCAAGGAAAAGGCTTCCATCCCATACGAAAGTATCATCCTGCGTGGTTGCATTATCCG
CAACACCGACTGGGTTCATGGCGTAGTCCTCAACACGGGCAAGGACACAAAGATTATGATGAGTAACTCGGCGCCTCCGTCAAAGATGAGCTCCATGGAC
CGGTCTATCAACCAGTACACGGTCGTGTTGCTGTCGATCTTAGTCATCTTCAGTGCCGCTGGTGCAACAGGAGCGGTAGCTTGGAAGAGTAACCATGAGT
CTCTGTGGTATCTTGAAGTGGCCGTGTCCGACCacagcgtcttcgtggaTTGGCTCATTATGCTGTTCTACTACTTGCTACTCATGTACCAGTTTGTTCC
CATTTCGTTGGCCGTCTCTATGAGTATGGTCAAGTATCTCCAAGCGCAGTTCATCCAATGGGATATCAATATTTACCACCCTGACACGGACACACCGACA
CTAGTGCGCTCAATGTCCCTCAATGAAGAGCTCGGGCAGATTTCGTATATCTTCTCAGATAAAACTGGCACACTCACGTGCAATGTCATGGAGTTCCGGA
AATGCTCAATTGGCGGGGTTTCATACGGCAACGGAACAACAGAGATCGGGTTGGCAGCTATTCGGCGCGCTGGCAAACCACTTCCTGACATGACTTCACA
GTCCAAGGGCCCAAAAGTCCCCTACGTGAATTTCGATGGTCCTGAATTGTTTAACGACATGAAAGGGAATTCAGGATCCGTTCAACAAGGACGCATTGAT
GCATTTTTCACGCACCTTGCTGTGTGCCATACCGTCATCCCGGAACGCCACGAAAATTCGACGGAGATTACACTttcagcttcatcgccgGATGAGCAAG
CACTCGTCGCGGGTGCCGGCTACTTCGGATATGAGTTCGTGAATCGATCCCCCGGCGTCGCTCACGTCAAAGTTCGTGGTACTGTTCAAAAGTATGAAAt
gctcgacgtgctggaaTTTAATAGTACGCGAAAGCGGATGAGCACCATCATCCGTCATCCTAATGGGCGGATCTTTTTGTACTCCAAAGGCGCAGACGTG
ATCATTTATGGACTCCTTGCaaaggacaaggaggaggaatcGATCTCATCCCAACTCCAGGAGATTACCCGGCGTCACATCGACCAGTACGCTGAAGATG
GGCTTCGCACGCTCACGATTGCGATTCGTGAGATTGAGCGTTCATACTATGCAGAATGGGCGAACCGCTTTCACGATGCCCAGAACAACCTGAATGAAAT
CGATaagcgcaagaaggaccTACCGAACGCGATTGACGAGTGTATGAATGAGATTGAGcgcgacttggagctgctgggtgcCACTGCGATCGAGGACAAA
CTGCAATCTGGTGTCCCTGACGCAATCGCTAATTTGGCGTGTGCTGGCATCAAAATTTGGGTGCTCACGGGGGACAAGGAGGAGACCGCCATCAACATCG
GCTTCGCCTGCCAACTTATTACGAACGAAATGAAGCTTTTCATCATCAATTCGAAGAACGCGCCGACCTCAGAGATTCTTGAGAGCACTTTGAGAGACGA
GATTGGAGCTCGCAGTGCTGACGTTACCATGTATCTTGCTTCGCCACCAAGTACAAGAGGAGAGCTTAGAAATCTAGCTCTTGTGATTGATGGTGAGACG
CTTATGTTTGCCCTTCGTGGATCATGCCGTGCTCTgctcgccgagttctccCAATTCTGCAAAGCAGTGATTGCTTGCCGCGTATCTCCCGCTCAAAAAG
CTGAGATGGTCGCTCTCATCAAGGAGTATGTTCCTGGTGTTCGCACCCTTGCTATCGGAGATGGAGCTAATGACGTGTCCATGATCCAAGAAGCCCATAT
TGGTGTAGGAATTTCAGGCCAAGAGGGTATGCAAGCCGTAAACTCCAGTGACTACGCTATCGCACAGTTCCGCTTTCTGCAACGCCTGTTGCTTGTCCAT
GGTCGCTGGAACTACCGTCGAATGGCtcagctggtgctgttcaTTTTCTACAAAAACATCCTCTTCACTGCAGCCCAGTATTGGTACACGCTGCTGTGTG
GGTTCTCGGGGCAGAAGTTTTTCCTAGAAAGCGGAACGCAGTTGTATAACATCGCCCTGACGGCGATTCCGATCGTCGCATCCTCAATCTTGGATCAAGA
TGTCAATGATGACGTAGCTATGACGTTTCCAAAGCTCTACTTCGCGGGGCCTCGTGATGAAGACATTaacaccagcatcttctctCTGTGGGTTGTGGGC
GCTATTCTGGAAAGTCTCATCATCACGTTCATCACTATTAACGGAATGAACAAGGCGGGGCTAGATGGAGGCAGCCCTTCAATGTGGATGGAGGGCTTTA
TCGTCTTCACCCTTGTCGTGACCATTGCCAACTCCAAGCTTTTCATGTTCCAGAACAGCTTTTACTTCTTCAACTATTTCATCTACATCGGCTCTGTCTT
GATGTGGCTCCTGGTTGCGTTGGTATGCAGTCACATAGCATTCCTCTCTGACCTCACGTGGGAATTAATGTTGGAGCAAGCTTTTGAGCTTCCATCCTTC
TGGCTGGTTTTCCTGTTCGTTCCGGTGGCTGCGCTTTCGTACGCACATCTACTCAACGGCGTCAGGTCCACGTTCTTCCCGGAGTACTGGCACCTCGCAA
AAGAGGTCATCAAGTTCAATCTTGACCGCAAACTCCTGCAGTGGAATGACAATAGCAATGCGTCGGTGGCAGTACCAGCTCGGCTTCCGCACGCGAAAAg
ggccgccaagaagaacggctCGGTTATCCCCACAAATGGTCGGCCGCAGGCGCATAGGACGACGCTACAGAAAGCATATCACGGGTTTGCCTTCTCCAAA
GACGGTTATGCCGGTGCCACAGAGACTCGGTTGCTCATGAGTCGAAGCTCCATCACAAGTGGAACATGAGTGAGGTTAGGCCCTAGATGAATTTTCACAA
ATACACACATTTCTTCACTACTGCATCTCATCCAGCAATTGGTCACTTGGAGGCAAGGCGTAATGGCGGAGCAGGCACCACATTATCTCTTTCCGCGTAC
CCGATTTGAGATAGAAACCTCGAGTTTGGTGgggagaagagcagcagctcgtccatcaCACGACGTCTTCCTTCAAGTGTCGTCGCGGCTTCAGGACGAA
agtcagcagctcggcgaagATACAACCTAAAACATCGTAAAATCAATCATGCAAACACATCAACCAGCCTGTGCAACTACCGCAGCACCGACGTGTGTGA
ACTGTACCTGGCTGCGATTCCTTCCAGTCGCgtggcctgctccacctcataagcgcgtcctgcttgcCGTCCAGAGCGTCGTCTTTTAGCCCGCTGGTAT
TGCCGTAGGAAGCGAAGTTCGTCCTGGTCCGTCGCGTCAACAAGTTGAAAGGCGAACCGGTGCGGACTGCAGCGATTCAGCCGCGCAAAGCCGCGCAGGT
TCCTTCCGAGACGCAGCCGCTTCACTGTGCTGGAGACTTTTGCGtcgtgctcctgctgctctttgcGTCTGATCTCATCCAGTCTGGCAGCTTCGGAGAG
TTGTGCCAacactgcagcgtcttcctctAGATGGGTCTTGTCCTCTGCAGGCTGCGTAGCGGCTGCAactcgcttcttcttgcgcgtGCGCCGCACCACC
AACCGCTCGTAC