Description :
From Genome Similarity Track
Location :
scaffold_1141:4011- 5815
Sequence
1804 bases(100 bases per row)
ACAATTATGGACATAGGACATCAAAATTTAAATTCAGAGTTAGTTTTACCTTCTATCAACCAAGTCTTCATCACCTCCATTATTCCGGGCAGGGATATAA
CATATTGGCGGCCCGTGTGATCAAGATCGACATCAAGTAAGGCTTGACTGGACGCCCGTCAACTCCCACATTAAGTCCCCCACTATAGGAAGCGGCAAGC
ATCGTATTGGAGTGTTCGAGAAGGTCACACACCGACCACAAGACACCCCCTGTCTAAGATCGACATTGGCCAAGCCGAGTCTAGATCAAGGACACCCAAT
ATCGAAGACTCGACAGTTACTCGGTGCAACGAGTAGAAGTATCCCCGCTGCCACCACCAAATCCCGCTGTCCTGTCAGACAGCCCAAGATCGACAACAAG
CGCGTCTTTAGAGTTCACCCGAGGGGCGATCTAATCCCTCCGACGGGTACACAAGATGAGATCAAGAAACTTCACGGAAAATCGGAGTACCCCCTCCGTT
TGTCGGTAGTTCGGGCGCCGTGTGCAAGAGGACCTCTGCGATATCGCGATTTCACAGAATCACTTCGCCACACTGATCCTCGTCGGCCAACGACCTGGAC
AGCAGAAAGGCAAGTGGCAGGGTAGGTAACAAATTTGTGTTCATTGACTCAGATTGTTACCACTATTTTCCCATCCGGGAAGATTTGCTCTCTACATTAA
TCAAGCGCTTTGATGGTGTGTATTCTGTAGTGGATATTCCTCAAGTAGCTACTGTAACAAATATCATACAAAGTATTGAGTTTAACTCATTTACATTTAC
ATTGCTATTTACCTTGTGTGACGAACTGTCGTGTACTGTTCGTAAGTCAGGAAATATATTTATTTAACGGGATTTATTTGCTCCACGTAGATATTATCCG
TAATATAGTAGGATTTTTCAGAATGTTGTTCTTTTACGTGAGTTTTAACTTTGCCAAGTGATGGTATTTTACTGTGAATTTTATTATCAGTTTGTTCCTA
GGTTGCAAAGTGACTGGCGTAATTTTAGAAAAGTGAGTTTTGTAACTGACGTCGTGAAGGTATCCGCTATCATTTCTTTAGTGTCGCAGTGTTTAGCTTC
GTATCATTTTCTGTCCACTCTTTCTTGGACAAAGCAATTGCGAATATGAATATGCTTGTTTCTGCCGTGTACTTATGTGTTGTATGAGAGTTTAATGCAA
CCTTGGTCGTCTTCATATATTTGTAATGGGTACTCCCATTACATGAGTAGGTAGATATCATTTTTTTATTGCATAAGTATGCATGGTGTCTCATAGTTAA
TGTGTGGCACACAATCATTATGTAATTGGGTGAAATGGATGCTCATTTCAGCCAATCACACATTTATATGGATATTGGTGGTTCAGATGAGGCCTAGGGC
TACCGCTCACGCTTTAAATAAAAACATAGTTTATTTACTAAGAATTAGATACTTGTTCTATTTTTGCGAGCTTCCTCATCGCTACGTGTAAGCCAGTAAC
GATAAATACCTGGTCCGTTACAATTTTGTGATAGCATGTTGACTGCTGTGGTTTAACTCAGCAGTAGTAGATCCAGGAACAAGGATTCCTGTATGCAGTG
GCACATGGCTATGTATTCTGCTTCGATAGTCGAGAGCACTACTGTGAGGCGCTTCCTAGATTTCCAGGAAATTGGCCGTCCACACATGTATGTGATGTAG
TCTCCAACAGATCATCTAGTGTCAGGGCAGTTGACATAGTCTGAGTCTGAATATGCCGTAAGATAATGTTGCAGGCTGTACTGCTCGACATTTTGGATTC
CACC