Description :
From Genome Similarity Track
Location :
Scaffold_4:401072- 402573
Sequence
1501 bases(100 bases per row)
TCGACTTCATACTGGTTTGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGA
TCAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTC
CAATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATA
AACAACCCGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTTGGAATGGATC
TTTTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTG
TCTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATCGAACTCGTCATAGCCTTGAGTGTAGACTTG
GCGTCCCAACCATGCACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTTATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGT
CGGCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTGGCTTGTGGTCGGTAACTCAGCGT
AGCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAAAACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAAC
TGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACA
GCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATAACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGA
ATAACCTCTCAACTGTGGCTTGCTCTTACTAGTATTGCAGTCTTCGCAGGCTCTAACATGTTTCACCACGTCGGCGTACAGACCAATCCAGTAGTAGTCG
GCTTTGACTCGGTGATAAGTTCTGACGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGGCAGTTATGAAGTATTTCGTCGACCATGGTTGACGGTATCA
CCAATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCTAGTCGGCGGGCTTCATCTCGGCGGTACAACAGGCCGTCTTCGCTGAGTACAAAGACTTCTGC
GACTTTGCCGGCATTCTGAGCTCGCCGGTGTGTAAGGTTCTCCACTTCACCTCTCAGGTACGCCTTCAGATCGGCCCACCTGAATTCTTCATCTTGTGCC
T