Description :
From Genome Similarity Track
Location :
Scaffold_72:40106- 41407
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.58WD repeat and HMG-box DNA-binding protein 1

Sequence
1301 bases(100 bases per row)
AGCGCGTCACTGAATGTGAGAGATCCGAGAAAAGGCTAAGAGACTTCCTAGTCATAACAGACTACATCCCTGTTGGTCACGTCACATCAGACGGTAGGCT
TCTACACTCGATACATTCTTAATGTTTGCACTCTACTTCCATGGCTTCGGACGCTTTGCTGGAGGCGGCGAAGTGAACTTAGCGAGTCGCTCAAGACCAC
CAGCAGTCTTCTTCTTGCTATCGGCTCCGGACGACGCATTGCTCTTCGGACtcGGCTTCTtcAGAAACGGGTTGGCAGGAACAACAGATCGCTCgaTTCG
TGGCTTTGTCGTCGTCACGTTGCTCGGTTGCGCGTGGTTGTCCTCCTCTGCTCGTAGACTCTCCTCTGCGGATTCCGGCGCTCGCTTCGCTCGAGGAGAC
GAAGGTGCCGACGTAGCCTTTTCATCCTGCACCTGCGGTTCATCGTGCTCTGTTGGTGGTTGAGGCTTCGGCTGTCGCGCCAGTCTTGGCTGTGGGCGTG
ACGCCATGGGCTCAGCAGCTTGTGTtGGCTGAGATGTATGCCGTGGGTGGTGCGACACTGCTGGAGCGTGACGTTCCATTCGCTCGAAGCGGTCTCGGTA
CAAATCgTAAAGCTGTGTCTGCAATGCACGGAAACCAAAGTGTAcGGCCAACTTCTGGGCGATCTGGTGCGACTTCTCCAGGTGGAGACACTTGGCTAAG
TCAAGAAcaCGTGCTGGTTCGTCATTCGTGCATGCTGCTTTCATCATAAGGATCAGCGACTTGTCCATCTCGGCTTGTTCAAACACTCTCTTGTCTTCCG
TCgCAATGTCGGCGTCGTCTAGGGCGGACAGACgAaCCTGTtGCCATAAATCATTCACAACTGGAGGTGCACCATCACCCTTCGAAGAACGAGTTGTTGG
GAAAGAAGCGTGCTGCAGCGCGAACTTGAGAGGCACAGGACGATGTTTGCCTCGGAGaCGAGGGCCCGATGCACCCTTCTCAAGGGGGAAGAAAAGGAGG
GTATTATTGACGACACCGAGTGTGAAGATGCGAGGGCGTTCTTCAGGCTTCTTTGACAGTGCGTTACCCACGACACCCAGTGGGAACCACTGCCAACCGT
AGCTCTTGGCGAGGGCCTGCACGCAGCCAAAGGagTCTAcaGCATAGAGAACTCCTCGTTCGTCGAATCCGAGCCACGACAGGGTCGGgTATTGTGAAAT
AtcACGGCGGGCCTGCTCATTTTCTTtATGGCTTGCGAATACCTCCACAATTGGTGGcGTAAGTGGCAATACCCCTTCTGCAAGTACTCGGACTCGGTCA
G