Description :
From Genome Similarity Track
Location :
Scaffold_37:40103- 42323
Transcript NameFunction/comments
g9220.t1hypothetical protein
g9221.t1XP_009538296.1 hypothetical protein PHYSODRAFT_319805 [Phytophthora sojae

Sequence
2220 bases(100 bases per row)
CCGTAGTTTGCTTCACGTCGGTGTGTGACTTCTTCTTGATCGTCACCGAGTCGTCCGAGGCGTCGTACTCCTCTTCCAGGTGCCAGATGCGCACATTCTG
GTGCTCCGACTTGGAGATAAACTGGTTGGCGATGGTTGGGTGGAAGCTGATGAACTCCAGCGAGATGCCGTTGGTCTGCTTGTCAAAAACGCACTCCCAG
TTCCACTCCAAGCCATTCTCCGTCTTCTGCTGGTGGAACCGCCACATGTGCACGTTCTTGATGCCGATGCCACACAACAGTCGGTACTCGGTCCTCTTGC
TGCCCTTGAGGTACAAGCTCTTCGCCGCCGCAAACCCCTTCAGCTTCGCGTCCGAGTACGTGTGCGAAATGACCTTCGCCGTCGGCAGGCCAAATGCACT
AGCACCATCCTCGTCTTCGTCCATGCTGTCATCGTCGCTGTCGCCAGTAGTCAACAGCGACGAGGACGCGGCGCCGTTCGACTGCGGCAGGTCCGTAGGC
GACGGCAGTGTGATGCTGTCCACCTCGAACGCGCGAATCTCCGTCGAACCGCGGTACACGCCCGCGAAAATGAACTTCCCGTCCTCCGGGATGGACACCG
TCACCATAATCTGCGTGTACATGCCGCGCGGCATGATCTGGTCCAGCAGAACTCCTCGTCGGAAGACCAGCGAGTCTTTCGTGAGCGGGTACAGGTACAC
CATCCCATTGTAAAAGCCCACGACCAAGAACTTCCCGTTAGGAGCCACCGCCACCGAGGACACCGTGGAAGACACGAAGAACTGGTACTCGAGACCCACC
GGCGGCATTCCGGAGCTGCTGCTTGCTGTAGAGAGCGCCGGACTCTGCGCCAGAGCCTCGCGCACCACCCTCAAGTTGCCGATAGTAGCTGCGTCGAACG
TCACCTCGGCCTCGTCACTAGAGTAGCCTGACTCATCCGAAGAAGAGGAAGAGCTGCTACTGCTCTCCACAGGCTGCGGCCCGGTCTCTTTAGCCTTTTT
AGAGCTCTTAATGGGCGTAGGGAACTCTAGTTTCCGTGTAGGGTCGTGGCTGAGTGTGGAGGACGCTCCTGCAGCCTTGTGGACACCTGAAGAGCGCGGT
TTGTCTGTGTTTTTCCTGTTTGAAATGTCCTCAAGGACGTGGGCGGCTTTAAGCAGACCCACGCGGTCCTGCGTCGACTTGTTGGGCTTGAGGCCGCGCT
CCTTGAGCTTGAGCTTCTTGGCCTTCTTGTCCAGCGTCTTGTGGTGTGTAGAGGGCATGGAGAGTCCCTGGTGTGCGCCTAGAGGCCGCTTCGCGGGCTT
GGCTTTACGTGCACTGAGTGTGAACTTGTTCTGCGGCTTCTGGGCGTTCGGCGCGGGCTCTGGCGACAGGAACGACGGTGACGTGAAGCTCTTGCTCTGC
TCTTTCTTCTGGGCCATGATGCCGCTGCTTTTCGCCGGCGTGGAGGCTGCAACGAGCGCGACGAGGCCGCTACTCGGCGACTTGGACGAGCTCATGGAGC
AGGACTCGGAGGCTGGGAGCGGAATGCGGAATGGGAGCAGATATCCGCGAGCGCGCGAAATTTCCCGCCAAACGGTTATTGACGTATTGAAAAACGCCAG
GTGGTGTGGTCCACATCCATATCTGTCTGATTCTGGTCTGATTCTGATTGGATGGAGCCCACTTTGCTAGAATCGTCGAGGAAGTCATGGCCGACAGTCG
GTCGCCTGTGCTGGAGCCCGGCGCTGACCTCAAGCATCTCGGTACGACGAGTACTTGCGGCCTTCCCCTGTATTTCCACCCAATACTAACGCTTCCATTC
GGGACAGAATCCATGCTAGACGACAAGAACCAGAAGCGCCGCAGCAAGAAAGCCATCGAGGCCTATGAGTGCGTAATACTATTTAAAGTATTTCTTAGTT
CGTGGTAGTAGTACTAACGAGGATTCTGCTGGATTATTATTTTGCAGGGGAAAGTTAGAGGGTTGGTCTCCTGCCACCCACGGAGAGGAGGTCGTGCCGC
CCATGGAGAAGCTCAGTCTGGGTCCTGCAGCTGACAATGAGGCCAAGCCAGCTGCTCCCAGTGACGACAAGAAGCTGTCCAAGGCTGAGAGGAAGAAGCT
GGCGGCCGAGGCCTTCGCCAAGTCCGGAGGGGTCCCCAAGCGGGAGAAGCTCAGTAAGGCGGAACGTCGAGCTCAGCAGGAGGCCAACAGGCAGAAGAAA
GATGGCGGCGGCAAGCCGAA