Description :
From Genome Similarity Track
Location :
Scaffold_229:4010- 9166
Transcript NameFunction/comments
Phypl_g5644putative polyprotein
Phypl_g5645conserved hypothetical protein
Phypl_g5646hypothetical protein PHYSODRAFT_531818

Sequence
5156 bases(100 bases per row)
gagcagcggctcccGCACGAGAATTACGCGgtcgagcagcggctcccGCATGTGGATTACGCGGTCGAGCAGGGGCTCCCGTCCGCTGATGATTCCGTCG
CGCAGGACCAACATCTGCGCGACACCGGCCTGGTCGAGAGTGAGCTCCCACGCCTAGAGGAGGGTGACGTGTCATCCAGCGAATCATCATCCAGTGCGAC
TTCGGCCTCAAGTAGACACTCGAGGCGACTGAGGAAGTCCAAGCGCAGCCGATCAGGACGCTGTCGCCCCCGGCGATTGTCTTCCGTGCTCGACGACACC
GTCCACCGAGAtgctcagcgtcgtcgagtACTCGGAGAGATCCTCAAACCGAGTACGCCGCGTCGAAGTGGCGAACCCTCCCTCCGATGCGGTTTCCATC
ACGCGGCTTCCGGGTCTCTCCTGGAAGCATTTCCTTCGTGACTTGAAGGCCGGNTTCGTCGCGCAGTCTTGGACAGCGCTACAAGACTCTGGTAACCCAG
TATATCCGCTTGCTCGTGAGTACGAAGACATCTTCCCAGACAAGATTCCAGCGGAACTCCTCGCCGAGCGAGGTGTTCGGCACAAGATCGACCTCGTGCC
CGGATCGAAATACTGCGTGACGCGGCAGTGGCCACTACCGCGAGACCAGGTCCAAGCCATCGATGACTTCTTCGAGGGTCGACGCAAGGCTGGTCACGTA
CGTGAGAGCATTTCTCCACACTCGAGTCCGACGttctgcgtgaagaaggccacaGGAGGATGGCGCATCGTTCACGCGTTCAACAAGTTGAACGACGCCA
CCATCCCAGCGCAGACACCGATCCCCCGGAAagacatggtgctggactCCATGTCTGGCAGCGTCGTCTACAGCGCGATTGATCTGACGGACGGCTTCTA
TCAGATCCTCATGCGAGGAAAAGACGTGCCTCTGACCGCTGTAAGCACTCATGAGCGGATTCGAGAGACTGTCAGAATCTATCTGCAGAGTGATTGTGAG
AGATTTGATTGTTCCAGAGACGGAGTTGCCTAAGGCCCTTGTTCGAGTGAGAGCACAGCTTTCACGGTTGGCAACAATCGGCGGGGTAGGTTTAATGGTG
CGAAGCCTCGGAGTGTGCCAACGCCAATCGTGCCGTGTCCCAGGTCTTGTCCAAGTGTGGCTCGCTTGGGAGCCATTGATCTCGGGCTAGCCGTACATCT
AGCTCGGGTGGTTCTCGTCGACCACAGCAGCGCTACTAGCTCAGTATCAGTTTTCCCCTATCACCAGCAAGCCGCATCGATGCAGCCCTCGAGCAGGGAG
GTTTCTACGCTACCCGACGCCGTGCAAGGATGCGCGGCGTCGGCATCCGCGGCACCTGTTACGGTGTCCCAGGTCGGTGCCACCTCTGCTGCATCACCGC
CAGCCGTCGCTGTTCGTCATGAAGCGCATGCCGCCACTACCAGGACTGTCCAGGTCGCCGCTGCGACGAAGTGCGGCGCCATTCGTGAGCCGGGCTCCAC
GAAGATGGCAAAGGTGGTTCAGCGGCTCAAGTGGACGAACGCGATGGTGGCGGAGAtgctccgcctccgcttcgagAAGGGCGACGTAAAGCGTCGCCTG
GAGTCTGCCGAcaccaagacgaagaaggcaCTGGCTTGGCAGCAGTTTGCCAGCACTCTGTCGTAATCGCAGGGCACCGTTATCACCCAGGCGCAGGTTC
GGACATGCTAAACTACCCTTCCTGCTTGTGATATTTGCTTTAAGGTCTAATGTATTTGCTGTTGTTTTGTGTTGTCAATATTCTAGCTATATCAGAAGTA
TCGCAAAGTGAAGTGCATGTATCGGAAAGGAAGACGTGAGCGGCGACAAACAGGAAATGACACCAGTGAATCTTTTGCTGTCGATGAGGGGTTATGGGCT
GTTCTAAACGACGCTTTTGCTTCGCGAGAGGAGATGAGCGGGGAAGTACTGCTGGATACTAacctcgaggacgacgggactgaagacgctgctgtagAAG
ATACAAGCACAAGCAAAACTACGTCGCCATCAAAAGGAAAGCTGCAGTCAGTTGTGAGCTGGCCAACGCTCTTCAGACAGGCATGGAGGCTATTGCTGCT
TCCATGAGCGCAGTGCCGACGGGTGGAgatcacctgcagcagctggctACCGCCATTCAGCAACAGGCACATGCAATGaccgagcagcgcgaggaaaCTC
GGCAGTCCCAGCAGGTACagttgcagcttctgcgagAACTGCTTGCGAGTAAATCGCAGTACCGTAATTGCCATGGGATGCTAGCGATAAGGGAGTACAC
TGCCATGCTGCCAGAAAAAGACTTTCGGATTGTTTCGCTTAGAATAGATGTCTGCAATGTCATTGCGCTTCACGATGCCTTGTTCGTGGGACAGTGGCTG
CTCCGGGTCGGTAAAATCTTCATCAACTCGCGCTCGGGATTCTAGGCGGAGCGGGTCATTAGACGACACTTGGTAGCTGTCGCCCAGCATTAGCAGCAGG
TTGTCTTGGACGACTTCTGCTCAAGTTTACCTAGCAATATCTGAAACCTGTTCTTGAGCTTTCCGAAGGCGCATTCTACGGTGATTCTTGTGCGCGAGTG
TATATAGTTATATAtgcgcttgcgctggtcCTCGGCAGCCTCGTTCTAAGGAAACGGAGTCAAAAGATGGCCCCACAGCTTGTACCTGGCGTCGCCGAGG
AGATGCTTGCCGGGAGGGATGTACGACGCCAACCTAGAAAAATGAAACACATACTTAGGGACAGAGCCAACGTATGCCAGTACTAATTCGACGCCTTACC
GTTTTCGGACACCCGATCCGTTCCATAATGACTGGTCATTGTTCAAACCAGCACGGATAGATAGCGACGACAATGCCCCTCGGTGATCTACGATCCCTTG
GACGTTGACAGCAGGAAAGCCCTTGCGACAATACCACCCTTCAAAATCCCGGGGTCGTGGGATTTTAATCAAAGTTCCGTCAAGAGCACCTACGACCCTG
GGAAAACCAGCGATGGCTTCGAACCCTTCTTCCACGGCATGCTGCTCTTCTAGACTTGCCATGACGACATTCCGCTTTGCCATTttgaccagcacgtcga
gcgTGTCGTTTATGTAGACTACTGCATGGGGCCGCGAGATCCCCATCACACTAGCTCCCTGGTCCATCGTGCTCCCTACAGCTAGATAATGCAGAGTTAG
AACCACCCGTTTAATTAGAGGCGTCTTACTGTTAGCTGCAGGCAGGCCGTCCGTCGATGCATCCACCCCCTTGAAGACACGAAGGAAGGAGGCTTTATCG
CAGCGCAGTTTCTTGTAAAACCagttggtcttcttggcaCACATGGCCTGCTCGAAGGTAGAGGAGGCGAAGGTGGAGGTTGCCCccgatggcggcgctc
gcgcagaCGCTCACAACAACCGCGAGGACTGCCACGTGCGCTTTTTGTATGTCCATTTGCGTTGAGCTTTCTCGACTGAGTGGCTGTGGCACAATTGCAC
CAGACCGGGAACACCTCGTGCTGGTGTTCCAGTCGTGgctgtgctggagctcaaaTTCCAAAGTTCGGTACCGTGTACCAATTgtattttagccaatcat
cGGGACTTAAAATTTCAGCACAGAACTGTTTTCTTGACTTGAACAAGGGCTTAAACACCACTGGAATCTGGGAGCTTGCAGCTAGAGTTGTTATTTACTT
TTATACTTAACTAGGATTAAGTACGTATTTAACGAATCGAAGGTAAATACCGTTAAGTATTTGACGTTTGATAGTACATTTTGGTAATTATTCATTCATT
GTTGAGTACATCCTCAAGTCATACACGGCTATTTTAGTGGGGTGATGCTGCTTTCCAGCGATTTCGATGCCCATGAGGCAACATACCCACGTGCAAGTTT
AGAACTCACAAGCTGGTTGTCACAACTACTCAATCATCTTCATTATACTATTAGATTAGATATGTAAATATAAATAGTGTGTGCTGAAATGATTGCTCTA
TTTGCGGTCAGGTCTGTCGTATTTAATTCGTATTTAACCACTAATTTTCTGCATTTAACTGCGGAATAGATCGTGTTAGAACCACCGAAAATGAAACGGC
TCTTAACCCTAACCCGAAATACTTGGGGAtggatgtcatggcactcaaatATCAAAAGCGAGCCCtacgaagaggaagaaagcGCGTCGCTGAGCGAAAA
GAAAATATGATGAAGCGGTTTGGGTGTCACAGAACAGCAACTGCCGATGTTATCTAGCGGCGTAGCCTGAAGGCACGGGCAGTGCTAGCAGTGAAAGAAA
CGAAGCTGCCACTTTGGCTAGATTGATTTCACCCTTCCCTGTCATAATTTATAAAGCCTTTGAGAAGCCATATCCGCACCGGATATATTCGAAAAAACCG
AAAATTCACCGAAACAAACCGAAAGTGCTCTTTTTGTGCGGTGCATTTTCGGTTGTTCTAGCGTGTTCCGTTTCAGATCTCAGTTTGTTGTCTAACCAAG
GCCACTGACATGTACTCCCATTGGAAAGGCTTCCTCACAACCCAGTCGCTCGAGCGAACATAGAGACCTGGGAGGCAGATCTCAAAGCGCGCCACTTCCT
CAAGGAGCGCGAAAGTGCCTTGTTGACGGGAAAGCTCGCTTCCAGCGTCAAAAGCTCCGGGTGTGTTAGACCAACATTGTTATTGTTGTACTAGTTTTAC
ATTTGGGGTATAGCTGGCGCATGAGAATCTGATGATGAGATGCGGCACTGGAGGGCTTCAATGTGTGGATCGCGTTCCATGTTCCCATACGTTAACACGG
ACGCGTGCACTTGACGGCTACTATAAAAAATATACCATATGTAGCATacagcacaagcagcgctGGCTCCTCCAATACTCGGCCGCAATAATACATATAC
CGGTACCTGTGGTCGGCGATAGGTTGGATAGAACCTTCACTTGTCTTGGGATCTGCTCCTGCATTACATACCTCAAGCCAATCCCCATAACAAAATTCAA
TGGACATAGCCTTCCAAGGTTCTTCTTAGTGATTTGATGTCGAGCGCGTAGAATCCCCGCACTCTGCGTTCCGACCTCCGCTCCGCACTCGTGCAGTGCC
TTTGTAGTCACTGGGCATGGCCTCCATCACACATGACCGCAGTCGGAAGACTGATC