Description :
From Genome Similarity Track
Location :
Scaffold_800:401- 4687
Sequence
4286 bases(100 bases per row)
GAAAATGAAAAGGAGAGGAGTAGAATCCTCGGTGGAGGTGTTTTAGAAAGCGTGGAGTGTGCTGATGCTAATGAGGGCACCAGCGAGGGTTCGTTCGGCG
TGGTTTCGAGTACAGCGTGAGACGAGCCCAAGGGTCACTCCAAGATGATGAAGTTGAACACTGGCGAGAGACAGGGGTGGTGGTCGGCCAAGAAATTTAA
CCGAAGGATCACAATGAGAGCTCTGGTGCAAGGCGCTGTGAACGACCAGCGAACGAGGATCCTCCTCGACACAGGAGCGAGCGTTAGTGTGATCACTGAC
GCCTTTGCCAAGAAGTTGCGACTCCGAGATGTACCCGATCACGGACGCCGCATTGACATTCAAGGTATTAACGAAGGCAAGGTGTCTACGACGCTTGCCG
GAGTAGTACTAGGTCGTCGTGCTTACGCGGCGAGTGTGCGTCAAGATTACGCTTGGATGGGAGATGGTGTACGAGTTCGAGATGTGGGTAATGGCGCATA
GTGCAGGCGTCGACGTACTCGGGGCCGACTTTATGATCCCAGCTGGGATCCGGTTGGACCTGTTTCATGGCGCGGCGCAATTACCGCACGAAGTTCAAAT
CCCACTGATCAAGACCAAGAACATGATCGACAGCAAAGAATACGGCTCCCATGTTAACGCCGGGCCACCCGAGCGTTTGGACATTCAAGCGCACGAGTGG
CGAGAATATCGACTAGCGAAGCTCTAAGTCGGGCTGGAGAACACGTACTGTGGGTTCGTCGAACGAACAAGCCAATCCCGTCAGTAGCGAGGTTTCGGCG
TGGACGGCCTCAGAGCATTCGGTTGACCAACGTGTCTGATCGAACTGTGTACCTACCAGCACACGACTCGATCGCGATGTGGATTCCAGATGGGGATTTG
CCACGAGGTGACGGCTATGTGCGTTTGGATTCAAAGAAGTACCAAGATTGGCAAGTGTTGGCCTACTAAGGTTGCAGAGACCGCGAGCTCTTTCAGCGTG
AATGTGAAATCTACGAGCAATGGCTTGCAACTCAGTCTTCGGCAGTTAAGCGACCGGACTATCCAGAACCCAGTGAGGTGCTAGCACGACCTCTAGAAGA
CTCGCCAGTGAACTCTAGTGATCGTCGGACGTGTGCAAAACGCTGGGCACTGATCATGGAGGAACGTGAACGAGTAGAGGCCTGTCTGGTGTCTGGGGTG
ACAGCCGGGGACTCGGCCGACGGTCAACCTTCCGAAGAACCTTTGGACACTTACACGACAGCTCACGGCGGGGGGCAATATTGCAAACGAAGCCTCGGTA
GCGCGTACACACGAACTACTGAGCCCGGTAAACGTTGTACATACACCAACGAGTGTTCGTGTCAAGTCTGGGGTGACCACGGAAGCGATAAGTAACAGCA
CTTGGATATAATGGAGTCACCAGTTTTGACGAAGTTGTCCCGGCCTTGTATGCCACCAAATCTGCGAACGAGACATCGGTGGTTGATCCTGAGGATGCAG
GCATCGCGCTGAAGGTGTTGAGTACGGCACCGAGTGTTCATCGCGAGAATGGTGCGAATGCCGAGCTGTCAAGACAACGGCCGATCGAGGCACTCGACAA
AAGTCAACAGCCCAATATGGCGGTTGCCTGCGCATTCAATATTGCGAACAACGACTCGGCAGGTGGCCCAGAGATGAGAAACCAGGATGTGAAGGAGATG
GACCCAGTACCGACTGTTGAAATCAAAGCGGATGCCGATGTTGAGTCAAGGGAAGAATCCGTAGCTACTTTGGACGAAACGTACATCTCGGTTGCTCGGG
TATTAACGACCAAAGGAAATGAAGCAACGGAAGATACGAGAAATGACTTCTACGAGCACCCAGCTAACAACATTGACTTGGAAGACTACGCGAAGGAACT
GGCATTCCTGCCGGACCCGACCAAAGAGATCAACACGACGATAGACTACACTGCGTCTAATGTTGCTGATCCTCACCTGTCGACTGATCGCCGAGAACGT
CTGGTCGCGACGCTCAAGAAACACGAGCACATCCTGATTGCTAGTGGTAACGCACTGCCGCCGCCAGCCTACGGAGCGGTATGCGATATCGACACACAAG
GGCACGCCCCAATTAAACAGCGTGCCCGGCGCGTGCCGCTACAATTTCTCGGCAAACTGTACGAGCTGCTGCGCGCTTTGTTGCGAGCAGGACTGATCGT
CTTTTCAGATAGCCCATGGGCATCGCCGATCGTGATTGTGATGAAACAGAATGGGCTAAACATTTGGCTCTGCATTGATTACAAGATGGTGAATGCTATC
ACCGCGATCATGGAGTATGCAATGCCGCTAGTCAACGACCTGTTAACCGATCTCAAACGCTACCTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCT
GGGCGGTCATGATGACCTTGCGAGCACGTAGTGTCGGCGTTTGTCTGCGCACTCGGACACTTCGAGTGGTTGCGCATGCCCTTTGGATTAAAAAACGCGC
CGATGATCTACCAGCGTATGATTGACAACGCACTCTGGGGGTTCGTTCTAAAGGAGGTTGGTTTGAATACTTGGAGAAGATGCGTTTAGCTGAAGAACAA
GCCAAGGAACGTCGTGGGCCAAGTGCCGAGGATTCGTTTTAAACGAAGTTCGCGGCAGACCGCGAAGCACCGGTGGAGGCCGACCCTGTACTACAACTCG
TCAACAGCCCCGTCGCTGACATGTTTACGAACGGGGAACCGGACGAATCATCGCTGGTACCTGTGTTTGGTCGACGGTCGTTTGTGGATGACATCTGCTT
CGGTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGACCGATTGCTGGCAAGATTTGCACAGTGTCGGATCAGTATTAGCTTTACCAAGAGCATCTTC
TGCCAGCCCAAGGTGGACTTTCTATCGCATAAAATTTCGCCAGAAGATATCAGGGCTGACCCCAAGAAGCTTGCGGCCATCACCGCGCTTTCGTTTCCAA
CGAGTAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTCAAGACTTCACGGTCTACGGTGCGGCGCTGTACCAGCTCAA
GGATGACGACTTTGCCGCTGAGGAGGCCTTTCTGTGGCACGTCGTTCCTTCGAAAACTTGAAGACGAGTGTTGCACATTCACCCATCCTCAGGCACTTCG
ATCGGTCGAAAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGATTATTACTGGACCCTTATGAGGAGATCGGGCGATGGTTGGCGAA
GGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCT
CTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTG
AGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAATCGGCCCTCAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAA
AGCCGAGCAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTCTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCACACCC
GAACTGTCGGGCTTAAACTCGTTAGAGGACCAACTGGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGAAGGACTGCCAG
GCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGAATCTACACGCCGAGGA
TCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCT
GAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACA
TCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGC
CAAGATCATCAGTTTCTCGACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCA