Description :
From Genome Similarity Track
Location :
Scaffold_2061:401- 3314
Sequence
2913 bases(100 bases per row)
CATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGTCTCCGGACG
TGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCT
CGCTCCACCAGGTCCATGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCT
CAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGA
GTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGG
GAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCA
ATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGGCTTCTTGTCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCG
TGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGT
GGGACAGCTGCTGATCTTCATGGAGTTTTCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCATGT
GGGACAGTTCTCGGGTATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGA
ATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCAGAACAAGGGCTCGTTCATAGATGCCCCTAGAAG
TGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGC
AGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGG
GTCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCT
CCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAG
ACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGA
TCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGC
TCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCG
CCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGC
TTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCATCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGCAG
ATCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAGTGAGCCTCCGCCGCGCTCGCGCGGACGAGTCGATGGTTTTCGACTTTGAGAA
TGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGG
TTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTT
AAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCACAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTC
ACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGT
GACCCCGTCACACTCGACGCCTCTCAGATTGCGACTGTGATGCGATGGTGTTCACCTGTAGTGAATTGTATGTTAGTTGGCTGGAGGGCGTTCATCGAGA
GCAACAGTTCCAGAGCAGGAAGTACTTGTAGCTGCGCTGACACTTACGTCGATAACAAATGCCGATCTCTTTCCGCCTCACGAGGCGTTTTAGCTAAATT
CTCTGCTTAGGAGTCACGCAATGCAAACACTACAGCCGGATGGTCCCTCTAGTTTTTGTTTTGTGTCTAAAGGCTGGTGCTGTGCCTTTCCTCGCTTCGG
TGATGCTGTACAAGCGAACATTTATATCCATCCATCAGCTCGCTCTCAAATGATATAAAAATGCAAACCTCGATTAAAAAACGTTTTAATTTTTTTTTAA
TTGGTATTGAGTT