Description :
From Genome Similarity Track
Location :
Scaffold_321:401- 3098
Transcript NameFunction/comments
g3765.t1hypothetical protein

Sequence
2697 bases(100 bases per row)
GTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAGGCGCATACTGGACGGTATGTCCAGTGTGTACGCGTTGCCGTGCTTCGCCAACACGGTAAAT
GGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGA
ATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATCGCGTCCTGGACAAACCGAATTACGGCTTGTCG
ACGCTGAACAAAGTCCATTGCATCCGAGCGGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGTCCGGCCTGCGCGTGATGTCCGTTGTTGTTT
AAAGTGTCTACGCTCGTCGTAGACACTGTGTTGTCGTTGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTTACAGCTGATACATTGCTTGTATCAGCGT
GCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTATGCTCGGTACGCGTGGGTGCCTCATGGCATT
CACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAG
CTCTTCATGGTGTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGGCGACATGGACAACTGCGTCCCAAGAAGTG
TAAACGCTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACA
AACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTTCTCC
GCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCAAGTTGGG
CGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAAGTAT
GTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGCCACGACAATGCGATCTG
CGTTGTCGTCGACTACGCTGACGCACGTCGGCCACAACATTCAACCTTCCAGGTTCGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACC
GTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCGAGTAGATATACTCG
AAACTTTGCGAGTGCATATTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGCAGTTGCGCTAAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACA
CGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCG
CCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGA
CAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGC
CATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACT
TCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCTCATCCGACCTCCTATTCACAGCCCG
GCTGTGAATGAACACATCATCGAAATAGCTCGGTGCAAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACATCGCTGGGGCGTTCTTC
AGCCCCTGCAGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACC
CGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCGTC
GTTCAGCTTGTTATACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCTGGGACTTCGATTCCCGCACTTGT
CCTGCATTGCGACGACTTTCAAAGAAGGCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGCCGCGTGACGCAATACTTCGTTCCCGGCACGA
GATCAATCTCGTGCTGAACACCTTTCTCCTGCGGTAACTCCTCAGGAATGTCGTCCGGGAGTATATCCTTGTACTCACGCAAGACCTTGTAAAAGGG