Description :
From Genome Similarity Track
Location :
Scaffold_1499:401- 2170
Sequence
1769 bases(100 bases per row)
ACTCACGGACTTGAATTTTTGATTGAGAGAGCAACGAATGAAGGGAATACAACCCAAGCTCAATGGATGGAGAATTGCATCGTAGAACTACATCAGCAAG
CCTCACTCAGCATAGAGCAACTGAATCTCCACTCAACGGAACTCTGGAAGCAGCTGAAGCTACTAAATTACGGGGACTGGAACTCCCAAAAATGTGCAGC
AAAAGACGAATGAAATTCCTGACGCGAACTATAGTGGTAGCTCACGTGTACGCGAACGAATTGCTGCAATTAACGGGAGATGTTGGCCAATTCAACCAGC
AGACGACAACTATCGAGTACTTAAATGTTCTCTTCGCGGTGATGCAAGATAACCCAGAAATCAATGCGGTTATCCACCAGGATGAAACAGTGGGACTTTG
GACAAAGCTAGAGGAAATCCTCGCATCAAGTTCAAACCAAGGGGTTGAGGGAAATGACCCTGATAGTGAACCCTCACCCCAACATTAGAAGAATGAATAG
TACACGAACAAAGGAAAAGCAAGCGGACGGCGACTACTACAGCGAACTACACAATGTGGCGACTTTATTTGATGAACCACCGATAACTCGGAAAAAACGA
CGCGGACCCAAAACGAATTTAACGATAATAACGCAAAACCTGAGAGGCTTTGCAAAACAATCCAGAAGACACTGGATGAGCGGGTGGAGAAGAAAACGAG
GGACTCGAATGCCTAACATCTTACTCCTCCAAGACACACAAATGAAAACAAACCCAGAAATTACGAATATGACGAACCAGTGGCAGCGAGTATGGCAGGT
AACCAAACCTGACAACGACATGAGTTACTGGACACAAACTAAAACAAAATCAGCAGGCCTAGGGATTCTAGCCAGCTCAGCCATCAGCGCACGAATAAAA
CCTTGGCAGCAAGCAAGCTGGACATCACGTGTAATGGCAGTGGAACTAGACGACTGGCTAATAGTAAATGTATATGCACCAGCTCAAAGAAGTGAACAAG
ACCAATTCTACGCCGACCTCGAACCTTGGATCTCTCAACACAAATCTGTGATCATTGGAGGAGACTACAACTGTGTACTGACACCACATCAAGATCGAGT
AACTGGGCGCACGCTCAGCACGTCCTCAAACGAAAGCAAAATACTTCAAACGATGCTGGACAAATGGGATTACTCCGACGCGATTAGCCTCACCAAACAT
CTCGACGATGAGGAAGAAGACCATGACCCAATGCACTTTTACACGTGCTGGACCTACGATGGAGCAAGCAGACTAGATCGCTTCTACGTAAANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN