Description :
From Genome Similarity Track
Location :
contig_14:400973- 402698
Transcript NameFunction/comments
g3732.t1hypothetical protein

Sequence
1725 bases(100 bases per row)
CCATGCACCCTCAGCTGGAAGAAGCTCAGCTACACGGTTGAGGTCAAGAAGACGGAGCGATGCCCCGACGGGAAGAAGACCATCCTGAGCAACGTCTCTG
GTCGATGTGCGCCCGGTGAACTCACCGCCGTCATGGGACCGTCCGGGTGCGGCAAGACCACGCTGCTCGACATCCTCGCGGACCGGGTCAGGTCTGGCAG
CATCCAGGGAGAGATCGCTCTCAATGGCGAACCCCGCAACGTCAAGACGTTCCGGGGCGTCACTAGCTACGTGGCTCAGGACGATTCGCTGCTCGGGTCG
TTCACGGTGCTGGAGACGTTGGAGATGGCGGCAAAGCTCAGTCTGCCCAACTCCGTCACGCACCAAGAGATCGTCACACGAGTGCAGGCGGTCATTGACG
AGATGGGGCTGCGAGTGTGCGAGCACACACTGGTCGGGGATATCTTCCGCAAGGGCATTTCGGGCGGCCAGAAGAGGCGGCTAAGTATCGCCATTGAGCT
GCTATCGGACCCGTCCATCTTGCTGCTGGACGAACCGACCTCGGGGTTGGACTCGGCCTCGACGCACAATGTCATGCAGTTCGTGTCGAGGTTGTGTCGA
GAGAACAAGACGGTGATCTGCACGATCCACCAGCCTTCGTCGCTCGTGTACAACATGTTCACGAACGTGGTTATCCTCACGGCAGGCGAGACGGTCTACT
TCGGCCCTCGAGAGCCCACCATCGACCATTTCTCGGCTGCTGGCTACTCGTGTCCGATGTACATGAACCCGGCGGAATACTTCATCAGTTTGGTGAACTC
GGACTTTGAGGGCCACGCTGACATCAAGCGCCTCGTGGCCAGCTACGCCAGCAGCGCGATGGCTTTGAAAGTCGTCGACAACATCGAGGCGGACGCTGCG
GGAGTCCACAACGCGACCCCCGTCGTCCCAGTCAAACCTTCGGCGCTACGCCAGTTCTGGGTGCTCATGCAGCGCAACTCGCTCAACAACGTTCGCAACC
CGGGTATTTACTGGGTCCGACTCGCCATGTACACCATGCTATCGTTCATGGTGGGCACCATGTACCTCTCCACCAACGACGCCATCTCCGACGAAGACAT
GGTGCCATTGCTCTTCTACGTGCAAGCCTTCCTGGTCTTCATGTCGGTGGCTGTGCTGCCTTTCTTCATTGAACAGCGGGCGGTGTTCCTGCGGGAGCGT
GCGAATAGCGGCCTCAACGTCTTCAGCTTTGCGCTGGCGAACTTCATCGCGACTCTCCCCGGCATCTTTGTGATTGCACTCGTGTCGACGCTGCTCGTGG
TTCTGCTCTCGGGTCTCAACGGGTTCTGGTACTTCCTGTTGAACCTGTTCCTGTCGCTGGTAGTGGCCGAGTCGCTCATGCACGTGATCGGAGCCGCTGT
CCCGCACTATATCATCGGCATCGCTCTGGGAGCAGGCATCTACGGCATGTTCATGCTGTGCGAGGGCTTCATGGTGCCGAAAGACGTCATCCCGGACTAC
TGGATCTGGGCCTACTACATCGCCTTCCACTCGTACTCGTTCAAGTCGTTCGTGTACGAACACTTCATCCACGTGGACACCCCGGCAGCCAAGGCGATTC
TGGCGCGACTGAACCTCGAGGACGTCGACACGCCGCAAAACATGATCATCCTGGCGTGCTACGCCATCGGCCTGGAGCTCATCTTCACCTTCATCCTGTA
CAAGTTCCACACTGGGCGTAGGTAA