Description :
From Genome Similarity Track
Location :
contig_26:400859- 408089
Transcript NameFunction/comments
g5488.t1hypothetical protein

Sequence
7230 bases(100 bases per row)
TACGACTCGAGGGAGTAGCGATACATGTGGTTGACCTTGCAGAGCTGGCTCATCAAGAAGTACATCATACTCGCCTCGTTGGCAACTGGTCGGTACACTT
CACGAGCGAGATTGATCTCGCGCTCAGCGTCTTTGCCTTTACGCAAGGCGATGCCAACCTCAATTGCTGTTAGCTTTGTCTGCTCGAGGCCTTCAATCAG
AGGGACGTCGGATAAAATGTCGTCTGGAGCATTCGAGAGCCGCTCCAGTAGATCGTTTTCGAGCTGCAACAACTGGATCTGGTAGCCGTTGAACTCTTGC
TGGAGCTGGCGCTTTTGCGTCTCCAAGTCGGGCTGCTCCAGGTTGACGACGTTCGCAAGTAGTTGGTCCTCGAGCCCTTTCTCCGTCACGCTAAAGTCGA
TGAGCGTGCAGTACGCCAATATTTCAGGTCGGTAGTGTGGGTTTGGCAGCTTTGTGTGCAGGAACAAGCGGAAGCGCGGGTCCACCTCAATCTCCTCCGC
TGCAAACTGCAAGAACCAATTGCGCCCCTTCTTGTAAATCTGCCGCATAATGACGGGCTCCAAAGACGCATCGATCGCCTCGCCTAGGTTTTCCAGAATG
ACGCTCTGTCCGCTGGTAATCGCGATTTTCAACGTGGTCGTCCAGTTCTTTTGAGCAGGCTGTAGGATGACCAGAGACTGCCCTGCCGACTCTTGCTCAT
CGCGGCGTTCGGTTCCATTCTGTTTCTTGTGTCGGAAGTCGCGAGCACGCAGCCAAATGATGCCTTGCAGTTGGGGGTCTACAAGGAGCGGCCAACGCTG
ACAAGACGTAATAATGCACCCGTTCTCGATTGAGATACGATCCGCAGGCAGCCTTCGTTCATCCATTGAGCCAGATCGCCTACTGTCGCTTAGCACATCA
AGCGGGTCGACGCCCACGGTGGGTGACGGTGCAGGCGATGAAGCTTGTTCAGGTGATCCTTCCGTATCGGTGGCCATCTCCCCGTTCTCACTAGTGTCGA
CTCCGCTTCCGCTACTGGCGCTGAGGTCTGCTTGGCTTCCTAGTGTGATTGGGATCTCCCGGGTCACGATGTCTGGTAGCCAGGTGTGTTTCCACAGCTG
AGCACGGAAGCTCGCGTTGAATGCGCCAATGTAGCTGACAAATCCCGCCGCAAGCAGCGAATCGCCGATCAGTGAACTCTCACCAGCTCGTAAGACATCG
ATCTCATGACCCCATCTCTCATTCTCCGAAGCGAGCCCATTCACCAGCCGCTCCGCCAGCGATAGTCGCTCCTGACAAGCCTGTGCCTCAGCCTCGACTT
TAGCCTTCTCATTCGTAGCGTCTCGGAATGAAGCTTGTAGCGCGTTAAGCTGGCTTTCTACCTCCGCCACCAACTTCTGCACTGCGGCCAGCTCGCTATC
CGCCTCTGCCTTAGTTTGACGTGCTTTCTCAAGGGTGTCCATCAGCGGCTTGACGCGCACGAATACCTGATGAAACGAGATGATGTTGACAACCCACACG
CACAGGTTTGCAGCAGCCAAGGATTTGCTCTTCATCTTCTCGTAGTTAAAGTTCGGGTCTTCCTGGATCAGGGGCTCGACACGTGCCACGACTTCCAGGG
GGATATTCTCCTTATCATATTGCTCCAGAGATTGCTTAAAGACGTCCACTTTGGCCATCATCTTCTTGGCGTTATCCCAGCTGAAGTTCTTGGTTTCTTT
CTTCACCATCATTAGAACGGCTGCCGTCACCTTCTCCACCCCAGCAGGAGGTTTGCCCATCGACTTGAGCTCCGTAAGAGATGCCTTGTTGAGGCAATTC
ACAGCTTGCTGAGCCGCATCCAAGGCTGGTTTGGCAATCGCCAGCTCGACGGAAGCCTGTCCTTCAATTTGTGATGCGATTTCTGCGGCCTGAGTAGCCT
TCGCACGCTCTTCGTCAGCACGACGCTGCTTCACTTCAGCATCTCCACGTTGCTTGCCCATTTGCTCGAGCAAAAGCTCAGTCGCTCTCTTTCGCTCCTC
CACTTTCTTCATCGTCATCCTCAGCTCGTCTTGGAGTCCTGCAACATCGAGCGACGTCTTCTTGAGTGTTGCCAGACCAACTTCTAAGCGCTTGATCTTC
AGTGTTTGAGATGAACGCTTTGCTTCCAAGAGCGACTTGTAGAAACGGATGAGCTCCAAGAACGACGTCGGTGTCACGTAGTTGTGGCGCCCGTAGCTCT
TGGTATACATCGTACAGGCTATAGTGACTGACATGTGCATCTCAGCCATGTGGTGGCAAACGTTTTCCTGAATTGCACGCGTAGACAGCTCCACATCCTG
AAGGAAATTGAGTGACACATCCACTAGCGCTTCTTTCGGCCACGGGTGGAACCAATTCATAGTGCAGCAGCTGATCAGCGAAGGGAAATTCCTGCAGCGA
GTTCGCAGATCACCACCCACCGGTGAAAAGGCTAAGATGAGATGCAAGTTCATGCGCACACGCTCATAAAAGAACTCTTGAAGCTGCTCCTTTGTGTCGG
GGATGCCGCGTGCCTTCGCTTCCATCCGCAAAGACCCGGCCATTGACTCCATTTCTTCGCTGGAAAACAAATCCGCAATGTAACCAGACGTCAACACGTC
GCTCAGCGGAACCAGAAAGCGGTTGTCAATGATCTGAGAGTCTGTGAGTAGCAGCACAATTGGCTTGGCAGGCCGGATGCCAGCTTTGCGGTAGACGTCT
TTTAGATCTTCCTTCAGCTCGCTCATCCCGTAGGTTGGGGACGCACTTGTAGTCAATGACACCAAACCGTATCCGCAGATAAACGTTGCCAAGCGTGAGA
GCGACTGCTTTCCTGACCCGCCAACACCGATCAGCAGCGCGTTCCCGTGAGGGTTTGCCAGAATGCGAACGATTCGCGTCACGTGTTCCAACGCTTGGTC
GAACAGCACAAGACTCATTACAGGATGCGTCTCGTTGTACTCAGCGAGTTTCCGCTCCAGGCAACTAGTGAGTTGCGCTTTCTCAACGACAGGGACGTAA
CTGAGAGGACTACCTCCATACTCGCTGTCCATGGACATTGACCCGGAGGGTGCAGCGCCCAAGAAGTTCACACAAATGAGGGGCGCAGCGAAGACCTCTC
CTTGGTCCTCTTCAAAGTTCTTCTTCGTCTGCTCTACAGCCATCTCTGCGAATCGTTGAATCTCGCTTGGCGAGCTCATGCGGTCGCTGAAAACACGGAA
GCACTCGTGCATCCAAAGACGACAAAACTGGAGCGAGTTGTTTAGATACGCTTCAGGCCGTGCCATAAAGATGCCTTGAAACAGCGAGCTTAACTCGCGC
ATACTGAACACGTAGTGGAACTTCGTGGCAGTCGGGAGGAAGTTCGCACGCACCTCAGAGTACAAGTCAATGGTTGCAGTGATGATACCAGGGGACAGCT
TCTTGATCTTCTCAGCAAAGTTTGTCAGGTGCTGGTTTAGTAGGGTGGAGTAAATGGTCGTGAGATCTTGCTTGGACGGCATGCTGATGCACAACGTCGA
GAAATGGCGGTGAAGACGAGGATTAACCGTAAACGACCCGGCCTTGTTGTTCATGCAGGCAAGAAATTGAACGTCCTGGATAATCTTCTTGGACGAGAGA
TCATGGCGATCGTACCATGAGTTGTAGTCCATGTACTGCCGCAGCAGCGCAAGTGCAGTCTGAGTGCCAAACTCTTCGACGAACGGCATGTTGAGATCAT
CCAGGAAATAGATGAGTTTGCGGTTGTAAAGCGGACCAAACACACGGCCTGACCTTTTCTCGAGAAATTGCTCGAGACGACCTTGCAGTTCTCGAGCGTC
CATGTAGTGATGCATACTCACGTACGCGAAGGCAACATCATCTTCCAGTCCCTTCATGTGCTCGTGGACCAACGACGACTTGCCCGAGCCGCTGGAACCG
ACAAGAATTGTCGGGTTCCTCTTTCGCAACAGCAAGTCAATGATGGAGTGCACACGGGTAGACTCCATGGTGGGGATAACAAGCGCATGAAAGGGGGTGT
CGCCAACCGCTGTGTGCGCTGGTACCTTGTCGCCCCAGTAAACCAGCTCATTCCGTGTGATGTCGTAGTAAAAATCGAACATGTTTGCGTTGCCAGTCGC
CAGCATTGCTGCCATATTCGTGTCAGCACCTCCTTGAGTTAAGGGATACGAGGTCGATCCACTGTTAGTTGATACAGCGGCGAATTTGTACTTGGCGATG
GCCTTGAAGTGCGTGGAGAACGCGATACGATCATCAGTGCCCTTATCGCTCGCGAGCGCACCCCAAACGCCCACATTGCACAGTGACAAACGCATTCTCT
AGCACTTCAGGGGTTTTCTCGTGCTCGCCAACGGAGCTCAGTAAACCGTCCAACAAACGGCACAACATCTCCACCATCGCAATAGGGACTACTGGTACAA
TCGTCTCGGCCTTAGTCTCATCAAGTGCCAAAAACATAGAGTCCATGTACTTCTGGAAGAGCCCGGGAAGGATACCCGCCTCAGCACCGCTGTCACGCTG
CTGCAACCAGGATTCAACAGCAGGATACCAACCGATATGGCCTTCGTCTACGTAGATGATGCCAGCTCGAGACACGGTGGCTGGTGTTGCGTTCACAAGC
GACGAGATCTCAAATACGAGTCGCATCGACTTTGTCAATGGAATGCGCTCGTTCGATACGAGCGTGAGAACCTTGTTGTCGTCCATCACAGTGTTCATGC
TTTCGATCCAGACTGCATCGATGTCGCCGTCCAAGACTACCCACTTGTACGTTTGAGATTCGCTAAACGGCGCCGCATTCTTGGACATGTTTCGCATGAT
AGCCGATAGAACGCCGTCTTTCCAGTCATTGTCAAGAGTCATATAGCCGTAGAGTTCATCTGCTGTGATGGCTTTCGGGTTCACGCTCTCGAAAACGGTC
AGGTGCTTAGCCAACGCATTCCCTTGCTCATCAGCGTTGTGACAGGCCGCTAGTGTGCTCCAGATTGCACTTTTCCCGCATCCTGCTGGACCGATCAGCA
TCACACTGTGACGCACCTTGAGGACGTCTTCGAACTCCATCATTTTCTTCAGAAACCCATCTTCCGGCTGAAGCTTCTTCTGCGCGCACACACGAGCACA
CTTGGTCTGTAGAGTGTCGCTCTTTAGGTGCGGGAGCTCTTGGTTAGGGAAAAGGTCTCGGAGCAAGCCCATGAACACTGGGTAGTCTGGAGGCAGGATC
CGCGGCGTGTTGAAGTCTCGAAGCACTTGCATCAGCACGGTCTCTTCTGATAAGGTTGAGTGCGCACGACGCAGACTACCGGCGACAAGAAGCACCGACT
TCACCGAGCGTAAGCCCCAGTCGTAATGCTTCTGCTTCGACAGCAGCTCGCTGCTGAGATCGTAAAGTGTGACAAACTTAACTGAGAGCGTACGCGCCTT
CAAGAACCCCTCCGCCATGAGCATGTTTTCACAAATGGGCTGCAGGTCAGGTTTGATCATGGCACACGAACGAAACAGCGCCTTCAGATTCTCCGGTAAT
TCCGCACGTCCGGCGTAGCCCGGGTTCATTGTGATGAAGAACCCTACTGTCGGCACTAGTGCGATGGTTTTCCCAAAGAACTCGCAATTGCCCGTCCGTG
GCATTGCTATGGGCTGCTGAGCGCTTCCCTCTCCTGTAGAGGAGCCAACCTCACCATTACCAGTTGACGGGCCCCGGTTTGTTGCGGCTACCAGCAGCGT
CGTAGCATCCAGCACAGTCTTCACTTGCGTTGCTACCACGGACAGCACCTCGACTGAGATGCGGTTAAATTCGTCAAAAGCACCCCCACGCTCCAGTCTG
AGCTAGTCCACGAAAAATGTTTGCCATCGTCAAGTAGTTCATCTGGTCACTGCAGTTGAAAACGTAGCACTGGAGTCCCATTCCTCGAGCAAGATCCTTT
GTCGTCTCGGTCTTTCCTGTACCGGCAGGACCCGCTGGAGCTCCACCTAGACACAGACGGAGCGCGGTTGTAAGGGTGACGTAGCAGCGATCGGTGAGCG
GGGTGATCACCAAACGTCCACAGTTGCCAACGTACTCATAGCTGTAAAACGAGCGGAAGTCACAAATCTTAATGTGCACCTCCTTCTTCTGGCCTGTGCT
CGTCACGACAGGCGTCGAGTAGTAGCGAAGTTGCGATTGCCACTGAAAGTCCAGTGCGCTTGAAACCTTCTTCGTGATGAGGGATTGTACCACATCACGC
GCATGAACGTCAACAGTGATCAGGGTGATGATCTTCTGGCGGTCGAGTGCTCCAAGATGTCCCTGAACCAGCTTTATCAGCTCTTCCAACCGCACAGTCG
ACACGTCGTAGTATTTCTTGATGGCATCCTCGGTGCCATTTTCAAACTCCTCTAGCGCGCTTTCAACCTCTTCTGTCCAGACAATTTGACTCCCGAGCAA
GGCCACTTGCGCCGGGTAATCAAATACCCACGTGTGACGAGCGCAGTCGACTCCCCACAAAGCACTGCTTTCGACCGCGTCAAAGATCTTCTGACGCAGG
GTATCCTGCATGACAATCACGAGGTCGTTGAACCAATTTTCGACCGTGCCATGAATCAGGTGCGAGTCCAAAAACTGCACCACCTCCCCTTCCTTTGAAA
CCATTCCCATGGTAAGAAATCGTTCCTCCAGCTGGGTTGCAGACAGCGGTGAAGACATCTTTCTCCCGGATAGTGACCCTCCTGTTGAGGCAGTACTAGC
CTGGACACTGGTAAACTCGAAGGACTGGATGCCGTCGAAGCAGTTCCCGAAATGAGGCTGGATGCGTGGGGATAGTTTCCATTCGATAAAATCTCTAGTA
ATGACGCGTTGGAGACAAAATAAAAGCGAGGGAAGATGTCCTTCTTGCCATCTAAATACTGGTTGAGCGCTTTCTGGCAGATCTCCAGCTCGACCTGCAA
GTCACGAAGCACAACTTCACGGCCGTCGCGTTGACAACAAGCAACCAAAACGGACGGCGACATCCTGGCGTCTGCAAACAGCTCTTTCATTTCCTGGTCA
ACATGTTCAAAGCGCTGGTACTCTGTCGGTAGTTGACGTTGAATATCACCTGCGGAGCTGAGGAAAATGGACTCCAAACTGCACCATTGACGTTGCAGCG
TGATCCACAGCTTTAGAATAGTGTCGACGTTGCCCAACCGCAGCTGCCATTCAAACACCTTGTCCTTGAAGTAGGCAACAAACTTACCCGTAGCTGCCAT
CGTTTGCAGCTGAAGCTGGTGCTCTTCGAG