Description :
From Genome Similarity Track
Location :
contig_72:40080- 41651
Transcript NameFunction/comments
g12042.t1hypothetical protein

Sequence
1571 bases(100 bases per row)
AGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTT
GGTTCTTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACAGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAG
CTTAAGTAGTGGGTCTAAGCAGACCCATTACATACGCTGCGCCAGCTCTGAGGATGAATTTTCATGCGCGGCAGTCACCGCCGCCGCCAATTGCTGAGTT
AAGCTGTCGATTTCCGCGTGTAGACGCGCGATTTCCTCCGTGTGTACGTCCTGCTCAAGACGCAGCCGGTCACGGATAGCAGCGATCTCGCGCGAATTGT
CAAGGCGCTCTCGCACCACACACTCGAAGTCTGCAGCCAGTCGCTGCGCGTCTTGACAGCGGCGGTAGAGGATGTCGTATTGGCGTTGGCAGAACAAGAC
GTAGGGGGACGCGTTGGCATACGCCGCATCGATTTCGCGCTCCAGGCGATCAGCCCGCTCCCGTTGAGCGACATACGCGCGTTGGAGGTTTGCATGATCT
TCCTCCAGGTTTGACTGAGCGTCGGCGCGAGCTAATAGGTCCGCGAAGGTGTCCAGGAGATTGCGGGCCGCCCCGCGATCGACGTGCGGGAGAGCGATTG
AGAGAGTCGGCACCACCGGCGAGCGAGGCTCAGCTGCTGCTGCGCGATCCGGAGGAACTGTATTGGGAGCGCCCGAAGTACTAGGACGCGTCGGAGTGCT
GGAACCGGAGGTTCCCGGAGTGCTGGGGCGCGTCGGAGACACCATGTCGGATCCGGGAAGCGGTAACGAGGGAGTGCGAGGCGGCGAATGGAGTTGTGTG
TGCTGGACCCGACCGCCGTACGGCTGCGTGCCAGTACAGGGGGCGATTGAGGTGAAGCGACTTGCCAGTTGGAGAGATTGAGCGATTCGGAAGGGACTGA
TGGCATGAGATCGCGTTTGGAGGAATCGCGATGGAAAGATTGCGGATGTGTCCAGTTATGGCCAGTTGTGTACAGTGGTGTCCAGTTATGTCCGGTTGTG
TTCAGAAGACATCCACCCCCGGATTGAAGTGGATACATGTCGACCTGATGAGTATGGCGTAATCATTTATGCCGACCTGATCAAGATCGATATTGAGCAA
TCATTTCGATACGCAATCTGATCCAGATCGACATGCGACAAACATTTCGATACGCGATCTGTACTCACGATTATTGTGGGTACAATGGACCAATCTTTTC
GACACGGTACCGCGATCTTGGTACATCAGACCAAGTTCAAGCTACGGTGTGCAATCAAGGGATGCGCAAGCGGGATAGGGAGAGAGCAGGATAGGGAGAG
ATCTTTAGGACCTTTACTTTTGGTTAAGAGATTCAGATTTGCCTTGCAAGACACAAGTGGCGTCCATACTTTCCGGGGAAGGAATTACATTGGCCTACCC
GACGAAGGACCCACCCAGTCGACCAAGGACACGACGCAGACCTGGATAGCTTGGCCAGGGTGCGATCGTCT