Description :
From Genome Similarity Track
Location :
Scaffold_1442:4008- 6934
Transcript NameFunction/comments
Phypl_g13419hypothetical protein

Sequence
2926 bases(100 bases per row)
GACTAGAAGGCCGTGTTCATCACGATCTGCCCCGGTAGGGGGTGGATACTTGGCCTGTCCTTCGCGGAGTTCCACGAGAGTAGGCCACACGAAATGTTCA
TCATCCAGCGGTCTCAAAGCAGAGACGGGCTGGGTGTTTGGTGATGGCGGTAGGCTTCAAATCGCCTTTAACCGCTTCACCAGACGGTCGGAGTGTGGCT
GCCGGCCCAACGAGAGATCATATCTGCCCATAAGCTGTCGGGTCCGGGTACGTGCTCCACCACGTATCGGTAGTTCATCAACTTCATCGCCCACCGCAAC
AACTTCTCCTTGACGTGTTTCTTCACCGACTCGTGCGGCGCGAAGACGTGGATCAGGTTGCGGTGATCACAGTACATACGGAACGGCTTGAGCCGTAGCA
TTAGGTAGTCCAGCTTGTCGCACGCCACTGCTATCGGGAACGCTTCCTTTTCGATGACAGTCCAGCTCAGCTGGCTGCCAGTGAATGTTCCGCTCGAGTA
GTGTATCAAgtgatgttgctgctcgGTGGCCGGCTTCGTCGGGTCGAAGTCGGTCACCTGCGTGACGATGATGGCATACCCGACGCCCGATGCGTCCGTG
AACAGGCACGTCGTAGCTTGGTCGTCGGGGAAGTCGAGGGTGGCTGTGTTGGCCAACGCCTCCTTGACTTGGTCGAATGCACGGCGCTCAGCATCGTTGA
GATCGATCTCGatgctcgctgcagctcgcctAGTTCGTTTCGTCTTGGCTAGCGCTGCGTCGAGTTTGCGTTGGAGAGGCTCGACTTGTCTGGCAAAGTC
GATCATGCTCTCCCGCATCCAGTTGATAGCGCACACaaactgctggagctcgccaGCGGTGTGCGGGTACGGCAGAGCCCTCAACTAGTCCATGCGCTCA
GGGTCGTGCCTGATTCTTTGGCCGTCGATCACCTTGCCACACCACTTGACTTGGTTTGGTACAGGCTTGTCTTCTTCGCGCTCAGCTTCAATCCGAACTG
GTTGAGGAGCGAGAACAACTCTGCAAACTTGGCGAGGTACGTGTCGATGCCATCGACATACAGGAGTAGGTCTCAATCCAGATGAGAAGGTGCTCGTAGA
GTAGGCTAGCAAAGCACTCCTCCATGGTTTTCTGGAAGTAGATAGCGACGTCACTACAGCCCTGAGGTACGCGGCGCGGAGTAAAACGTTTCTCGTCCGT
CCTGTACGAGAGAAACTCTTGACAGAGCTCAGCTAGTGGCAATTGCCAGAAACCCTTCAAAACAATCGAATAATCCAAAGTGTTTCATTCCACGTGCATG
CCCACCACTAGTGATAGAATCGGCATCACTGCGGCCATTGCGTCTGTCACCGCGTTCGGTCCACGATAGTCCGTAGTTTGCCTGAGATCCATGATATCGG
CGGATTTCTTGACCGGCAGGACGGGGCTCGCCCATCGACTGTCAGCGTTTTCGTAAACCAGTACCAAACGAGAGTTAAAATCACGGAGAAATTGCCGAAT
GTGCGGAGGATACTTGCGGGGCTTACACTTGGTAGGTCGAGCCCCTTCCTGCAGTCGCACTTCGAGTGGAGGGACGTTCGCCGGAGGGTCCGCGCGTAGT
TTAAAGCGCCACACGTCGTAGGCAtgaacgacgacgcggagTTGCTCCACTTTATCGAGAGGGAATCCATTTTCCACTGCACGACCAATCATCCTCTCCA
CTGCAGCAAAAAAAGTCTTCATCACTGGGCTCGGGGTGACTTGCCACCGGGTCATCAGCCTCGAGCTCAATGGGGTCACCACTCGTCTCGTCGTCACCCC
GGTCAGCCAGCATTTCCAGCTGCCGGTCAACGTTAATGCCGAGAGAGTAAAGTAGGTCGTTGTCCACGATGAATTCGCCGTCATGGGCATCCACAATCAG
CACGTCCACCGCATTCATCTGCTCGACCGGTCATGTGGCAGTGTGGATCAATAGATGTAGATTAGCCTTCTAATCGGCCGTCACCCATGTAGAACCAAAG
GTCTGGTTCCGAACGGGGATTTCGAGGTCTATCGCTTCAACACTGGGGTCCTTCATCTTGAGTAGTTCCCAGTGTGAACGGCAGATAACTGTGTAGTCAG
ATCCACTGTCGGGACAATACGGCAGCTGCAGTACTCCATTCAGTGTAACTTCTCGGCCAACAGTAGGTAGGTATTCACCAAGTCGTTTGAGACGCGCACG
TTTGGCCAAGCCGGCCTCACGCAGTTTCTTGCGCATCTTTTCCTTCTCAGCTTCGTTTGCCTTGGGATAGTCACGAATCCAATGCATCTCTTTGCACTTG
GGGCACGGGCTCGGGCGGCAGATTAGCCGAGGCAGCAGGTCTTGCGTTGGACGAAGTCCGTAGGGCTGTCGGGGCAGGTGCTCTCGGCGGGGTCGGTCCC
cacggcttcttcttgtcgctaGTAAGCTCAGGTTTacgctgcggctgcttccCCTTCTTGGACTCTGGTTGCTCGCGTCGCTTGGCCTTCAGCCGCTGGT
ACTGTCGCTCGTGCTCTGTGGCTTTCTCCACGATGAGCTCAAACAGCAGCCTTGGATCCGAAGCAGCGAGTTTGTGCGTGAAGCGTACGCACTGCGTGAC
TTCGTCCTTCAACGAATCGGGGTAGAGTGGCGCGACAAGTCGTTTGACCTTCTCGCGAGCGCCTTCGTTGCCGACAAAGCATTCGGTCAGGCCATTGGAA
CGCATGACCTTGCCGAACTGGTTGAAGTAGTCGATCACCctggcgtcgacgtcgctcttAGTCATGTTCAGGCGCAGCTGTCTCTGGAACAGGGCCTTGA
TGTCGGGCAGGATCTTGTTCTTGACACTTCCGATGATGTGCTCGATCTCAGCGATGAGGATGCCCTCGGTCACGTCCACCGATGTCATGTTCAGCCGTAG
CTCACAGAAGGTATCCAGGAGCTCAG