Description :
From Genome Similarity Track
Location :
Scaffold_150:4008- 6145
Transcript NameFunction/comments
Physo_143740hypothetical protein
Physo_143741hypothetical protein

Sequence
2137 bases(100 bases per row)
CATGGTGGGCGCAGTGGTCTTCTCTATTCTCGACCTCGCGAGTGGATACCACCAAATGCGCATGTCTCCGACGTCAAAACAGTACACGGCATTCAGGACG
AACCATGAGATCTATCATTGAAACGTGGCGCCCATGGGTCTGGCCGGCATGCCAGGCACGTGGACACGCCTGATGCGCAAGCTGCTGAGTCATCTACTGT
TCGTGGTCGTTTATCTTGACGACATCTGCATCTTCTCGCGATCGATGGCTGACCACGTTGAGCACTGACGACAAGTCTGCGAAGTCCTGCGCGCTAACAA
GCCTTACGCCCATCCTGACAAGTGCGACTTCGGACAAGCCTCGGTGGACTTCCTCGGCCACACCATCTCTGCTGATGGGTTGCACGTGGACGCTTGCAAG
ACTCGAGCCATCGCAGAGTGGACCAAGCCATGCAACATCAAGGACCTCCAACGCTTCTTGGGCCTCGCCGGGTACTATCGTCGCTTCATCCACCAGTTTG
CGACGTTGGTACTGCCCCTGAGCTCTCTGGTCAAGAAGGATGTCGCTTGGGTATGGAACGAACACCAGCGCCAAGCTTTCAATGCCATTAAGCTCGCGCT
CCAGCACGCTCCGGTGCTTCGTCTGCCGGACTTTGAAAAAAATTCATCGTGACAACGGATGCCAGCCATGCGTGCATTGGTGAAGTGCTCTCTCAGATGC
ATGATGGCAACGATCTCCCCGTGGCTTTCTTCAGCAAGAAGCTGGGACCTCGAGATGAACTGGCCTGTTCACGAGAAGGAGCTCTTTGCGATCAAGCAGG
CGCTTACACGTTGGCGTCATTAACTCCATGGAGTCTCGTTTGAAGTGTACACGGACAATTCGGCGTGCAAGTGGTTTTTGCAGCATCCACGCCTGTCGGG
TCGCCTGGCCCGCTGGCTCGACTTCTTTGCGTCCTTCCAGTTCACTCTGCATCATCGTCCAGGAGCTTTGAATGTCGTTGCGGACGCGTTGTCGCGCCCC
CCTGATGCATCATCGAGTCCGGGGGAGGGGCAGGAGGATTGTGAGTCCAAGACCGAGCCGGTTGTAGTGTGTACGGCGTGTTTGACGTCTACCACATGCA
CGAACATTCGAGACGTGGTCTCACGACGTACCATGGCTACGGCGAAGCTCCAAAGCATACCGTCCCGTGATCAAGCTGTGATGCTGGCCGTCAAACAGCC
AGCCACAAAGGCACTCGGAGTTGGCACAGCACAGTGGCACATGAGGTTTAACGCAGCGTCAATGGAGGACAGCACGGTGATCAGCTCACTTCAGCTGGAT
AACCAAACGAAGCGGGCGTTTCAGAAGGCATACGGCAGAGATCCAGTCTTCAAGCCACTGTGGAAGTCCAGACGCTCGTCGGAAGAGTACGAAGTCATTC
GCGGGTTGATCTATTTGAAGAGCAACGACAGCCTACGCCGCCTCTGTGTGCCAAACAACCGGAAACTTCGGCTCGATGTCATTCACAACGCGCATGATGC
GGCGATTATGGCGCACCCAGGCATCCGTCGCACTCAGCTTGCTGCGGCACAGTGGTACTTCTGGCCGAACATGGATCTGGACATCAAAGCCTACGTTCAG
AGTTGTGAGTCATGCATGAGGTACAAGTCAAGCACGGGACGAAGAGCAGGAAAGCTTCAGCCGATCCCGTTGCCCGCTGCGTGTTGGGATGTTGTCTCGA
CTGACTTCATCACGCATTTGCCAGTGTCCGACGGCTTTGATGCGATCATGGTCGTGGTGGACAAGTTGTCAAAGCGTCCAGTCTACATCCCGACGCACAC
CACGGCGACTGCGGAAGACATTGCCAAGCTGTTTTTCAACAACGTCATCCGATACTATGGTATCCCATCGACCATCATCTCCGACCGGGACCCGAAGTTC
ACGTCGAAGTTCTGGAAAGCACTGGTACAGCTGATGAAGATCAAGACAGCGATGACGACTGCCCACCGAGCGCAGGCCGATGGCCAAACTGAGCGTCAGA
ATCGGACTCTCGAGGACTCGTTGCGATGCTCTGTTTCGTACCATGGCAACGACTGGAATGAGCACCTGCCCATGATTGAGTATGCGCACGCAACACTGGT
GTCCAGCTCGTCGAAGCTGTCGCCCTTCTTCGTCGAC