Description :
From Genome Similarity Track
Location :
Scaffold_181:4008- 16251
Transcript NameFunction/comments
Phyta_totarag5169replication factor C subunit 4
Phyta_totarag5170vesicle coat complex COPII subunit SEC13
Phyta_totarag5171hypothetical protein PHYSODRAFT_293820
Phyta_totarag5172hypothetical protein PHYSODRAFT_309136
Phyta_totarag5173hypothetical protein PHYSODRAFT_353495
Phyta_totarag5174hypothetical protein PHYSODRAFT_473874
Phyta_totarag5175hypothetical protein PHYSODRAFT_437295

Sequence
12243 bases(100 bases per row)
TTGGCGCGGACCACTCCACAAGCGCCGGGATCACTGCTCATGTTCAGCACCACatcgacgtccacgacgaaCGCCCCGGCGCCCGTGCTGCCCTGGGTGG
AGAAGTAGTAAGTATATCATCTTTCTTTGCATCGTCCCCTTGTTATGCATACATTAAtcatgctgttgctgcgctccAGTCGTCCCAAGAATGTGGACGA
GATCTCCCACCAGGAGCACGTGGTGGCCACGCTCAAGACGTCCATCGCGAATGGGCAACTGCCTCACTTGCTGTTCTACGGACCTCCAGGCACGGGCAAG
ACGTCTACCATTGTGGCTGTGGGGCGCCAACTCTTTGGCTCGGATTTCCGCAAGAACGGCCGCTTCTTGGAGCTGAACGCGTCGGATGACCGGGGCATTA
AGGTGGTGCGCGAGAAGGTAAAGAGCTTCGCCCAGGGCGCCATCAGCACTGCCAGTGGCCTGCCGCCCTTCAAGATCATCGTACTGGATGAGGCTGACTC
GATGACGGGCGACGCGCAGTCAGCCCTACGTCGCATGATGGAGAACTACTCCAAGGTCACGCGCTTTTGCCTCATCTGTAACTACGTGAGTCGCATTATC
GAGCCCGTGGCCTCGCGATGCGCCAAATTCCGTTTTGCTCCCTTGGAGAAGGTCTCGATGGCGTCTCGTGTGCGCTTTATTGCCTTGGAAGAACAGGTGA
ATGTATCGGATCTGGTGCTGGAGTCGCTGCTTGAGTGCTCGAACGGTGACTTGCGGAAAGCGATCAACTACCTGCAGAGTGCCAAACAGCTTTGCGGAGA
TAATGAATTGTCTCAAGACGATGTCATTGCTGTGGCTGGCCTTGCTCCAcctgagctgctgcagcaatttTGGGTTTCGTTGGCTTCGAACAGCTTtgag
aagatgaagacggacaTCGGAAGCATCCTGCTGGCTGGATATCCGGTGCTAACGATTTTGCGGCAGCTGAATGACGACGTGCTCGCACTAGAGAAGCTTA
ATGACTtgcagaaggccaagatctGTCTGCGCATTGCTGAGGCTGATAAGAGGCTTGTCGATGGCGCCAGTGAGCACTTTCAGCTGCTAGACGTCGCATC
CTACGCCATGCGCGTTTACCATTCGTcgtaatacatgtagaatcTTCCTATGACAATGATACAGGCATAAATAAACGGGAAGGCGATGGCAAATGAACAC
CTGCACAGTAGAGTTCCTAGCATTTGGTAACGAAGCAGAGACCGCCAACTCAAAGCCGTGGTGCGGAAGTCATCTGCTTGTCAAGTACCGGTAGTGCTAA
CATCTAGTTGCTTGTGATTGTAGCTGCACCTTGATCAGTTACAGAAGAAATCTGCGTCCATTCATGattgttctgctgcttccagaAGGTAACCtcatca
tcaccagcagcgacgctaAGCACTGAGCCCGTGAGCGACCAGCTTATCCGGTACACGGGCGCACGAAACGTATGCATCACGTGGGATGCCCACTCACCAT
CGGCCTCATCTTGAGTCCAAACACGCACCGTATGATCATCCGATCCGGACGCGACCACGTTCGCTGGAATACCTACATTCGGCGCCCAAGCCACATCGCG
AACCCAGTCGTCGTGTCCATACAAGGGGGTATTCTCAACTTCCCAGTAGCTGTTGCCAGGGTTGCCACCTTCTTGAGGGATAGTAACAAGCTGCCAGATA
ATAACCGCTTGATTGCATGATCCAGTGATCACGCGCTGGATAGGCCCTTGAGCCCCCTGCGAGCCCAACGAGTTGTAGGGTGCCCAGCTCACCGCCGTGC
AGCCCATGCCTTCCTCCGAGTTGCGAAAACTTGACGAGATAACCCACCCTTCACGCATACGGGTAAGGAACGACACCTGTCCGTCAGCCGATGCACTAGC
TAGACACAGCCCGTACTCGTACGGCGCCCAGGCTACACTCAGCACTGCCAGCGAGTGGAACTCGTGCACGTGTTTCAGACGCCATTCCGTCACGTTGCCA
ACTCCCCCAGCGccctgctgcaccagctcctcccGATAGATGTACACCTTGCCATCTTGAGCAGCCAGAGCCAGCACCGCACCGAACTTCGGGTGCGCCC
AAGCCACACGGTGGATGGGGGCTGCCGAGTCGTCGGCTAGAGGCACCACATGCTGTAGActgtgaagttgctgctcctgctgagGCTCCCGACCATCCTT
CGCTGTCGTATGCTCGTCACTGTCCCCGCCCGCCATGATGGCCTTGCACACGTCGTACACACGGAACGTCCTGTCGGACGAACACGTGACCAGGCGCTTA
CCGTAGTAGTCCAGCTGGATGTCGTAGATCAAGTCGTTGTGCTCCGTGTCGATGCTGGTCACGGGTGCCTGGCGTggctgttgatgctgttgggGGTGAG
GCTGTCCGTACTGCGCAGCAAATTGCCCGCCCGCCGCCGGGCCGTGCATGCCTCCTGCAAACTCCATCTTCGTTGTTTCTGTGCGTGTGACGGATACCTG
ATGCAAATGGGACTATTTTCACATAAATTTGGGTAAACGTTTTGTTTGTCAATTACAATTATagtccagcaacttgtttGACCAAACTCAAATTGGCCGA
GTGCAATGTTCGCTGTGAATGGGCCCAGCGGGCCAACGTCGCGCAACGAGCGGCGCGTGAAGAGCGACCGACAGCgggaggaagaggaggacacGAGGAG
ACGCTGGGCAGAGAAAAAGAGGGAGCATTTTTTCCTGGAGAAGTGTGCACAgtctggcagcagcaaacgtgGTGAGCGCACAGCGTACTGGTGTTTGTAA
AGGCAAACTGCAACATCAGTGTTCACATGCTCCGCTCGTGGTGTTTGGCATGCATTGCAATAGGCAAAGAGAAAGTGAAGGAGTTCATAGCAGAGTCCGA
TATTTTCAAGGTATGTTTTTGCTGGGTGATGCCTTCGCAACGCTCCGATTTGACAGCTTTTCGATCGTTCGTCGACAGGGATGCCGGATTGTGTTCAATG
GCCGCACGGGCAAAGTATCTTCGTACGTCACGTGAGGAGATAAACATGCGGTATGGTGCTAAGGCTTCCTTGATTGTGTTTTGTAGGTACTACTTAGCGA
AGTTGGTGCAGGAGCATGGTGGCAACGTTGCGTACGCGCATTGTTCGGTCAAATCAGGATCTTCCAACGCGTCAGGTGacatgtattaataaaatGTATT
GTGCACTGATTTCGCAGCTCGGCGCTGACTGCCACACGCATCACTCACATGGTCGGTTCCAACTTGAACGGGTCTAAGGCGGATAAAATGCTCCAGATAA
AGGTAAGAAGTGAATTCTGGGTTGCTCGAATCAAAGCTTGCTGTTGACTTAACGAGCACCTCTTGCGTGGCACAGAGCTCTGGCAAAGTCAAGTTCGTGA
GTCCAGGTATGTTCCTACGTTGTCGATGTCCGGTGATCTAGCTGTCATCTCAATCACACTTTTGGCTTGACGCAGAATGGATCTTGCAGTCTTTTAAGCG
TAAGAAGCGGCAGTCCAAGTTCGATTTCCTCGTGTACAAGGATTCCCATGCCGCAGGCTCGCTCCGTGCCACATTttcacgagcagctccatcaacaAAG
TGAGCAACTCAACAACGCACGCCCGTAATTAGCGTTCTGCCTCAGAGGAAACAGTGTTCTCGTAGTTCCGTGATAACGAAGAACGCAGCGCAAACAAACA
CCCGCTTGTAAAAAGAGAAAGAATATACCATGTATAGGGTCACAACTAACCAGAGTAGCATTCGTTGTCGCTCCTTTCAGCCAAAACCGAGAAAGCGAGA
CCTAAGAGAAGAGCGCAGAGCCGACCTGAAAAAGCGCAATCTGATACTCCTTTCCAAACGCCACCGAATCCTCGAACAGCCTTTCACCCGCGTCGCACAT
CAGCCTTATTGTTTTTTATCCTGTTCTGGACCTCTTGAGTGCCGCGCCTCTCGTGCCTCGCAGCACAAGACCCCGAAGATAAACTGCAGACAAATCAACT
AGCGCGCGACGCGAGGTAAACAGGACTCAACGACAGTGCTTAGCAGCACTTCGACCCGCCGTTGGACGGAACCTGCTGGCCGGGCGTCAGCTTGACGCCA
GCCTTGGGGGCCACGGGGGCGTTGGCCATacgcttcttgatctggGCGGCCATCATCATGAAGGCCTTTTCAACGTTGGCAGCGTTCTTCGCACTGGTCT
CGAGGAACTCAATGCCCAGGCTCTCGGCAAACTCCTTGGCGGCGTCCGTGCTCACCACACGCTTGGCCGTCAGATCGCTCTTGTTACCCACCAACAACTT
GTTCACGTTCTCGCAGGCGTATCTGCAAAACAGCGACACATATGTCAGCTTCTTTTGGAGGTTTTCCCGATACATAAACCTGATCTGACGCACCTATCAA
TCTCGTGCAGCCACTGCTTGACGTTGTTGAATGACTCCTGGTCCGTCACGTCGTACACCACGATAATGCCGTGGGCACCACGGTAGTAGCTGCTAGTGAT
CGTGCGGAAACGCTCCTGGCCGGCCGTGTCCCACTACAGAGGCACACAAAGTTAGATGAGTGCTCGTGCTCAGGCCATACTCCAGACCACAAGATGACGA
AACATTAACTAGGTGACGTACAATCTGGAgcttgatcgtcttgccgtccagcTCGATGGTGCGGATTTTCTGGACACACGCACAAATATGACCACGTCAG
AAATCCTGATTAAAACTCACCCTCAATGGGCCTCAGAGGTGCCAGTCGGCCGGCTAGAGCAGAGTGTGTGTTGTCTGTCACTCACAAAGTCCACACCAAT
GGTCGAGATGTAGCTCTCAGTATACGTGTCGTCAGCGaaacgaagcagcagacacgACTTGCCGACACCCGAGTCAccgatcagcagcagcttgaacagg
TAGTCACTGCACGCAATAGACAGTGGTCAGTCAGATCTTGTCTTCATTCGGCACCGATAAATCATCTACAACTTGGTCCTGCACGCACTATTCCGGGTTC
ATCTTGGACGATTCTTGGGATAAAGCGGCGGACGAAGGCGCTCAATCTGCAGCACGACACAGTCGATCGAGTCAGAAAACATTACCAAACTATGGACTAT
GGCTCCACGTTCCCTCCTTCCGCAACTCTAGAATCCGAAGAAAGATCGAGGATCCGTCCACTTCGACCAGCCGCCGCAGCGGGGGGAAAGCGAGCAGAGT
ggagggagggggggggcggAGCGTTTGCAGCTGGCGCTGACTACGTCCTAGAGTCTGCTACCTACACAAGACAGGAAGAAGGAAGCGGCTCGCGCTTTCC
GGGCGTTCTTTGGGTTGTGTGTGCGAGAGAAAGAGAAAGAAATGGGGGGAAACGGACCGTTGGGTTGGCCTCCAGATGCAGGCGATTGGTCGAAATGCGC
CTTGAGATTTTGCGACCAGTTGGAGGCTTGTGATTGGCCATCATCTGCTTGAGATTTCGCTTAAaatttcatccaatcaaaaCCAGTAACGAAGTGACTT
AAAACCTGGTGTGGCAGACACAGCAATCGTGGCCGCCTTAGACAACCAATTGTTGCCAGCGACGTTGCGGCAAAATTTGCGTGCAATCGCTAAATGTGCG
CAAATCAAAAACTGAAACTTGATGCGGCTCAAATTGCCTGCGCGTTTTGGTAACGATGAAGTCGACGGTGCATGCTAAAAAAAATACTAAACCGTACCGA
TAATAATGCAGCATTTTGGCGACGTGCCAATCCGTCCTAACATCCTAACGTTACGCAGGAGGCGCCGCCGTATGCGAAATGCCGGACAGATCCCGCGCTG
AGCATGCCTTCCACGAGGAGTGTGAACACTTGCCAGCGATAAGCGAGGCTTAGCATActcaccgtcgtcgccgtaTGCATCTGCTACAGACAACCTTCCT
ATTTAGCAGTGCCATGGCTGGGCCTGTCCAGACGAAATCGGTCAACCCTATCTATTCATGTAGCAGTGCGAGGTGAAAGAGAAAACGCTGCTGTAGCGAC
GCGTTGGGGTCGCCGCCAGAAAGCAGCGGCGTGATGAATCTTTGCCATTCTACCTCTCCGTGCGGCGCCATGAACAATGCCTGCCTGCATCGCATATTCC
GCACTGATTTCCGAGATTCATGGTTCAACCAGAATGATGGTCTCTCGTCCTCGCTTTACTGCCGTCAACGACGAATTACGTATCGTTCTCGAAGACCTTA
TCCTTACAAACCTCAGCATACCAAACTCCATGAGGCACAGAAAGAAGAATTACGGGCTAATATTCAGTGGATTATCTTCTTTTCCGCCTAGGGTTGTGTG
TCGAGGTGGCTTTTTGTTCCGCCTTTGGTCTCCCCCCACACAAAGAAAGTGGGGAAGTCGAGAAGAAACGTCGAAGGCAAGTAACCAGATCGAGGCTAtg
ctggcggcggcgtcaGCTCTCGCCACGCTGCGCCACCTCAGCTCTGCCCTACATGCATATGCGTGCATGCGTGTGGcggttgtgcagcagcaactcgcgt
CTCTCAAGTCGCTGTATGGGACGAAAGAGCGCGAGTTGAGCTGGGTCAACCCCACTCCGAATCAGCACTGCATTCCCGTGTGGATTTAGTGTCTATTCGG
GGTGTAGTGTGCGAGTTCAGTGCTAATAATGTGGAGCGACCCTTCGTAGCGAGGCACCATGACCAGAGCGGGAAAGAGACTGACTGTGGGCGttgtcgtg
ttgctgtttccCTTGATACAGACGTAACTACTTCGGAGACACACTTAGCAAGAGACGAGCACGCCGCCAGTCTTTTTCGTTGCAACATGAGCTCGTTCAA
GAAGGAACACCCATTTGGTACGTGGCATTTAGGTCTCCAAAGTCTCCGCTTTAGGCGGCGGGAAGCGCTAACGACGTTTGACGGTGCCGGGCTTTTTTTT
CAGAGAAGCGCCAGGCCGAAGCCCAGCGCATCCGATCCAAATACCCCGACCGAATTCCGGTGCGTGACCTCCGTGTCCAGTGGCTCATTGACTTTAGTGT
GTAATTAGCTAACTCACATTTGTGTTTGCCATGTTGCAGGTGATTTGTGAGAAGGCGGACCGCAGCGACATCCCGGACattgacaagaagaagtaccTGG
TGCCGGCTGATCTGACAGTCGGCCAGTTTGTGTACGTGATCCGAAAGCGCATCAAATTGAGCCCCGAAAAGGCaatcttcatcttcatcaacaacgTGCT
CCCACCCACCGGTACGGACTTTGATACTGGAGTCTTATCGTGTGTTGCTTGTCTCTTCGAAGTACTTACTTTAAAAATGACGTGTTTTGTTTCATTTAGC
TGCTTTGATGTCGAACATTTACGAAGAACAGAAAGACGTGGATGGTTTCCTCTACATCACCTACAGCGGCGAGAACACCTTCGGTCAATAGGCCGTACGT
GCTGTCGGCGTGCGGGGGAACTGGATTTTGGTTGAAGATTTTTttcgtcgttgctgtagtGGGCTGCGAACTCCTCGCACTCATTCCGGGAGCTGCGGTG
TTTctttgcagcttcagatATCCAgacgtcttcttcagggAAGTGATGGCAAGATGAGTCGGTGAGGAGGAAAGCTGAACAGCCACAGACCACCACTACT
CCAAGCACGACAAGAAGTATttcctgctgcgtgtggTCCATTCTTCTAAAGCTGGCGATGTGGATATATCTTAAGAACAAAACCCCAGAAAAATGCATGC
AATTCTATTCACTCGCTCATGGCCCTCGCTTTTTGTTGTACCTagtactaccggtagcatTGTTTCAACGGGTAAGTtagtacttgaagtatctTTCTAG
TCGCGCTGGAACTGCATCATCTGCAGGCCTTGACCAACGACCACAACTTCGTCAGCCGTTCCAGCCGAGGTTTGCCGTATTGCAAGATCAGCAATATCAG
CGCATTCTGAGAATACAACACCTCGCCACTCCAGCTTGGTGTCGTTCTCGTTGCGATAAATATTCCATTTGCTCACTCGTTGGTCGTAGCCAGCGGCAAA
AGCGATTTGGGCATTCACACATGCAACAGTTTTGATAGCTGAACCGCTAGCATTCACTGTCCGATTGTCGGACAGCATTTGGCATGATGGGAAGAGGAGT
TCACGCAGATACAAGTTCTGGTCGTCTCCGCCGCTGATAAATGTCACGTCAAGGCTCCCCTCTTCTGTGCTCTTGGCACAGGAGACAAGATTGATGCAGT
TTATGCCCATATCGTGCGCCAAGTAGTTGCCACTTGGTTGCAACTCACTTATCAGCCCCTGTAACTTTTCCCTGAACTGCCCCACATCTTCATTGGATCG
AACAAGCGAAGcaatctccttcagcagcgcgcttAGTTCCCACAGCGTCACCAAGCCATCAGTAGAGCCAACGGCTAACCCAGCAACTACTGCGTCGTCA
TCACCTTCCTGAAAACCAACGCAGGACAAAATCGGTTTTCTTGAGGCAGAACGGCAGTCACCAAGCTCGAAAAGTTTGCCGCGgttcacgtccagcagca
gcaattgaaTGGAGCCCTCAGAGTTGCAAGCCGTCACAAGCCGATAATTGTCTGAGACATAGGGGATCGCAAACGTAGCAAGCCCGAGGATACGGTGGTC
CTGAGCTGTCTCGGCACGTTCCTGGCCGCAGACATGACGGAGTTGGTCACTTTCTCCAGGAACTAGCCACACGTTTAGGCGCTGCTTTCCGCCGCCTGAG
AGCACGATGTGTTCCTCGACGCCATCAGGAGTTTTGCGCCGGAACGTTGTGAGTGCCCGGACAGTAGTTGTATGGGCAATTCCGGTAGCCACGCTGCCCC
AACGTAAGCTTCTGCACTTCTCTTGACCATATTGAgcgcgacgacgatgcagcATAAGGCTGTTGTCCTCTGCTGCAGTAACCAACCGCTCACTTCCGAG
GAAAGCCACGCAAGTCGTCATGCGCCAGTGATGATGGTCGTGCAGAGAGCATCTAGAGAAAAATGGAGAAGTCCTGGAAGCACCGTGCTCAGGCAGAAGA
GTAGAGTGCACTTTAATATCAACCTGTTGCTTTTGTGTTGCCGGGGGCGTGAACACAAATGTATGAGAGGGTAAGGCCGACTCTGTCTCATCCCCACGGA
TGCAAAGCGCATGGGGGCGACGCCAACCACCGCATGCCACGTTGAAGACACGATATTGCGCAGACAAGTTGTACAGAATAGCTTGTGACGCGTGGAAGCC
AAAAACCATGAGGTCATTCTTTGTCGTGCCGCTGGAAGATAAAGGTTGGCTCCACCAAAGCTGCTTGACTGTGGAGATACCTCGGATGGATTCACGGCCT
AACTGTGCAGCTGTCAGTGCTCCACTTGCATCTTCTTCTAGTGCATACGAGCAAATGTACCCGTCATGGCCTCCCGACAGCATGGTGATGTGGCGGTTTT
GAGCATCGTCGAGTAGAAGTGATGCCACCAGTTCACGCCCGTGGGCACCTTTAAGCACGAGAGCAGGGGGTCGCGCCACATCGAATTCATTGTCGCTGCC
CTTCCGAACAAGGGGGCGGTGAAAGACGTACACGTTACCATGCCCGTCACCTCCCATGATATTCCTGGTCTTAGCCAATCGGTCTACCACCAGGATTGAT
GACATTGAGCTTTTGGCAGGGATCTTGAACGTTGCCATAAGATCCATTGCGATGGACGGTGGTGTCAGGGTGTCGCCTGCCTCTACAATGGCAGGTTTCC
ACTCAGTGAGGACGCCGTTAGCACTACTAATGAATAGCGAGTCTTCCTGATCCCACCAAATCTTCATAACCCGAACGTTGGTCTGGGTAGTCCATGAGTA
CAACAGAATGCCCGTAGATGCTTCAACAACACACACGCGACCCGTTAcatcaccaagcagcaagaagtgcCCAGAAAAATCAATTGCGAACGTCGACAGT
CCACCAGTTCGGCTttgaacggcagcaccgtcaAAAGGAGGGATAGCGAAAAAGAGTTCTGCTGCGAATGATGGCAGGTCCAGACGGAAAATCTCGCCGT
GCTCGGAAGCTACAAATGCCGTCTTGCCGCTGTCCAGAGTGCTGAGCACGATGTTACGCACACTGTGAGACGATGGGccactcttcttctttttcgATGC
AGTACACGTTGTCGAAATAGGAACACGAATAGTTTTACACAAGTTACTTGCCCCCAATGCGTTGGAAGAAGACATGAGCTGGTGTGTAATATCCCAGAGT
TTGACAGCGCCATCACCTCCTCCCGTGGCAATCATCTTTTGCGACGGGTGGACGGCTGCACGCCATACATGTCTGCCCATGTGTCCTTGCAACGTGGCTA
CACAGTCGCCGTTAAGATCCCAGAGCTTGGATAGACCATCTTCGCTCGCCGTTACCACACCGCGCTCCCAGAAAGAAACATCCCAAATGCGCGCCGAGTG
ACCCCAGGCTCGGAACACTGGAGAGTACGCATTCGCAAGTAGTCCAGCACGGTTCGACGTTCTCAGCAACTGCAGTTGCTCAACCGTAGTTTTCCCATTG
TTTGACCACAGCTGCACTGTGCGATCGTCCGAGACGGAGACCAACGAGCGCGCATCTGACGACCACGCCAACTTGAAGAGGACGCCATCGTGAGCATGCA
GCCGTTGCGCCGggtcgacagcagcgctcgCCTCTTCCCTTCCATTCTCCATCGGATTCCACAGCAAAATCTGCTGAAATACCGTTCCCGAAGCGACCAC
AAGCTCGTCCAGCGATCGTCCGTGAAACGCCAACGCGTACAAAATGCAGCGCTCGGCACACTGCACGCTGCGTAAAATATTGCTGCTCTCAGGATCCCAT
AATTGCACTAAATTGTGAGCAAGTCCAactgcagccagcagcttcttgttctcctccgACGCAAAGTCatccgtcagcagctgcacgtcgAACACCCAGT
CGCAAAACACTTTCGGTTTGCCCAGCGTCGTGAGCTCCTCAAGCCCCTGAGCAGCCTCACGAGTCTGCGGCAAGTTCTGAAAACACGACACACGCTTTTG
ACCGAAGAAAGCGCCAGCAAATGAGTCCGTTGTagcgccagcgccagcgccaggaagTCCGACGATGTCGCAGCCGTGCAGAATGCCTCGCGTCAAGACA
GTGTGTTCGCTCAGCAGCTCTCCCGTAGCGGTTGCATAAAGAGAGAGCGATGGTCCCACGCCTACGTAGAGTATAGACCCATCTGATGAGAACGTAACGA
GCGTCACGGCGCCCAGGAACTCCTGCTTCTGTATCGACGCCATTAGCTTTGCGATGAATGGCGAGCCATGAAAAGCATTCTTGAACCGGTATTTAGCATA
ACGCGAACCGGTATCGCCTCGACAATTGATTGACGCTGCAACGTTgcacatggctacatgcaTCTTGCAGTGGAGTGGTGAGGATAAATTGATGTAAATA
TATTGCTGCTAATAAATAAGTTATTGTGTGTAGTCTAGACCTCGATGTTGGAAGCTTCGAGAGCGACCCGCCAGCCGTCTTCTAATGGCAACGGCGGGCT
GGCAGGCTGTCGTCGTttctgatgctgctgctggtactcACTGAGCTTGGAGTACACGGGTTTCTCCATCTGCAATATCTTCCACACGGAGCGTGCTTTA
CGGAATTcgatcttgctcttgctcggGTCCGAGACGGGCGAAAAGTTTTCGGCTTGCAGCGTCCGTTCGAGTGTCTTCAAACTGAGGTTGCCAGGAAGGG
TGGCCCcccgcaagaagaaatcgCGCACTATCGGAAAAATGGAGTTGGCGCATGAAGTACACTTGGGCACCGCTGAAAAGGTGTGCGATGTCAATATCTG
CACGAACTGATGAAGTACGAAGCGACGCTGGTTGATCACGTTGGGCGACCGCGAgtgcagaagatggcgtctcggGAACCAGTAGCTGCGCAGCGTCTGA
GCGAACCACGCGCAGCCGAAGCACTGCGGGCGAGCACCACCCCCACGacgcaagaagaacgagcgcagcaccttctgTAGTTCCCGAAACTCGGCGTACC
GGTGCTCAACAGACCACTCAAGATCCGTATTCGCAAGCGAGCACTGCAGCACGTACTGAGTGGGGTCGCGTATGCGCGGACTGGGCTTCACATTCACTAG
CTTCACCACGAGTTTTGGCTCGAGACTGTCGGGTCGGCACGCGATACTCGAGTGGAAGCAGTCATCGTCGAGGTACATGGCTTCGCTACCGAGACGCGCA
AACTCTCCACGTGGGACCAAGCAAATTGCaaagtactacatgt