Description :
From Genome Similarity Track
Location :
Scaffold_128:40079- 45400
Sequence
5321 bases(100 bases per row)
CATGCCACAAGGATGGAGGTGGGATAGACAGAGGAGTTCATTGGTCATTCTTAATTTTACTCACCGTACTCATTAGCAATATACGACTAAAAGACTGCCA
CAGTAGAAACATTTTTGTTATCAAACAGTTGGGCCATTGCCATAATCTCTAGCCACTCTATTAATTTTGACTGTAACGGAGAATGGACACTAGGAACTGC
GTGTTGAACTGCGACGATCCCGTAACTCTTCCTTTTAATTAGCTTGTCGGTTCTTCGATTTTAAGCATAAAAGCAGATAGCCGAGCTTTACTAGTCTCAC
CTGCGCGGCGCTTCTTAAAGCTAATTTTTGATAACGTGTACCCATCATATATCGTATACGTATCTATCACCGTTTTCGTGCCCGCCGGTGGCGCCTAGAC
ACGCTCACAGTTGGCATGAGCAAATGCAATTTGCTTGTTTAAAAGCATTGACATCGCAATGTTCTGACAATCATTTTCTATTGAACCAAGATCGCGATGC
TGCTTAATATTAGAATGTGACAACTTTGTCTATTTGCATTTACGTTATGATTTATGATAATTAATTGATTTAAACTGGTCCACTGGTTGTGCACATATTA
AAGGGTGGGTGTGTACCTATAAATTTCCAATCTATTATTGTCACAAGAATGGTGGCTTCTTTTAAGGTAGTCTGGGCCTTATATGAGTCCGCGGAATGGT
AAGTAGCTTAGAAGTCCACTTGCTCCGCAAGTTTTTTTTGACGGCTAGATCTCACTATATCACTGGTCTTTGCACTAATGATGAGCCTGTAAAGACATTT
TCTATCAATACTTTTTCCTTTTGAGGCAAAAGTGTAATATTATGTAAGTGCCAGTTAGATAGCCCGGATTTAGCAATCTCGTCCAAGAGTTGCCGTTGGA
CAGCACCAGTGATCTATTGACATCCATTAATTCTCGTGTAGAATACTCGTCTCCGTCCGAAGATCGTACGCTTGAAGTCTTTATTTGAAAAACTGACTAA
GCCGTGATGCTTTATAATATCTGCATCATTACAGTACTAATGGCTTCCTCTTGCTTGGCAATACCGGCATCACTATTGAACGAACAAGGTATCTAGGAAC
AAGTGATCTGAATCAAACTAATATGTCTCCAGCTACGGGATTTATGATATCACTATTTGTGTCACTTTAAAACATGTCCACAGGGATACTTCATTCCGTG
CTGCATCTGTATTTCGAGGCGTAATTGTAGTATTTTTTCCCAACCCCACCACTTTATAATGTCAATAGTTCAGAGAACACTTCATATTCTCGCCCCACCA
CTACAATTCGGAGACACTCCAAAACTCTTTCCAAATCTACCTCCTTTAGGTTGCCACCAATACTACACCTACTTATCGCAGGCACTCTTTTATGAGTTCT
AGGATCCTACCACCCTTACACACCATGTGACCTCGCTGGTTACATACCAAACTTTATTGGATGCAGGTGGTAGTCATGGCGAGAACTGGAGCGGCGTTAT
GTGTTCTGAAGTGTGAACCCCGGTAGTATAATCTTCGAGGTTGATTACTTCAATCGCGTAATATAATCAAAGTGACAGGCTGGTTTATTTATGATATTGA
GTGGTGTGATGAGGATGCTCTTAGACGGGATATAGCCTCTATTATTGGATACTGCTCCATTTTTTTCTTGCATTCACAACATGTTTAAGCACCTAGTGGT
TACCCTTCCGTTTCGGTCAGAACTTTCAACTATTTCTGCGCTTTAAAACGTTTATATAACTATGCATATCCCTGATTGAAAAGTTATTGTCGATAATGCC
TCCTCAGTGTTTCCATTGTATCTTTTGGGCTCTAGAGAGGGTCCGCCGGCAGCTTTGTGGAGTCGCAACATTTACACAAGAAACAATTACTCCCTCTATT
TCTGACTTGCGTTTTTAGTTGCAACATAACTCTCTTTTTTTAGTACCAGCTAATGGACTTTTTTCGTGTTGCCCCTTTGCTACCATGGGGTGGTATAATG
CAGGCAACACACGGTGTATCAACATGTTGGTACTGTGAACTTGCGGCTTAAGTCTGTAAATTAATGGCTAGAACTTCTGACCCTACTGTTTGAAGTGTGG
CTCGAATGAAACTCTGTGCTTCTATTAATTGTGAAGCCTATGATCGATGCATATCAAGCTTAAGGGCACAGCCTTTTCCTGGTTATGAATATATTTCGGG
CGATCATTTTATACTATCTCTGAATTATAGTACTGATACCTGATTTCAATGATGCTGCAGGTCCCTTATCGATGTTTAAGCTTAGAGTCCACGCTGTTGT
TGATCTTCACACTAAGTAACTATCTATTCACACAATAAATTGCGGTTTATCCATTACAGTTTTACTCTGAGGCAACTACTCACTTACTATCGAATCTCCC
GTTTCGGCAGTTTCGACCTTCCCATCCCCATATAGCAGCTGTTTCACCTGTTTGACCCGAGCGTCACGATTCCGTGTGAGGCACTAATATTTTCGTGTTG
CGATTGACGTTACGCGCTATCTTTTAGGCCTGTTTACGGTTACAGTTGGAGTTTGTTTTAGCATATTCTATACCGTGGGCACTAATAAATTATAATGGAC
AGCTAAAGGCTATTACGTTGTCCGCCTTTGCCTTTCACCCTTGCGCTTTTGGCTTTATTTTCTTGCTTTGCTTCCGTAATTTAGCTGTAAGAATCTTGTC
TTAGGACTTTCGCCTTCGGCCATTGGCTTAAAAACATTGGCATTTAGACTCTTTGTCTTCGTAACTATCTTTTTAGATCGTATTGGAAATTATAGTGCCT
CTTCGAGGTCACAGTTTACACTAATCGTAGTATTTTTGATGCAAGTCATTTTTGATGGATCGGATACTGGCGTTTTTACGGACCTCTAGCGCCTCTAATT
CTACCATTACATCACTAGTACCACACACCGTCCTAGGATGGCTTCTAGCTTGATAGTAAACTCTCCTTGGGGACAGAAGTCTATGTGCCGGGTTCAATTA
ACTCATATCCACATTTCAGCGCTCAAAGTTTACCCGCAGCCCATGTAACTTTAAGCTTCCAAAATTTACCCAGTTCCTGCTTCCCAAAAAGCTGTCGCTG
GTGTGGCTCGAACCAATACCGACTACATGCACTAATATATGTTAGTGGCTAAGAGTGCATTTTTTACCTTACATTGTATGTGGTGTTTGTCATTTACCCT
TGCGTATCGTCGATACAGTGCTCGCGAAAATGATGGGCTAATCTATTCTAAAATTTACCAAATAAACACCACTATTTTAAAAAATACCACCAATAAAAAG
GGCTTGAAGGCGGTATGTATGGTTTTCCTAAAACCCATTTATATCGTCTCTATAAGCAAAGAAATGAGAAATTATCCCGCGCTCGGCACACCAAGATCGC
GATGAATAAAGGCCATATGCCTTTGCAGCCCAATTGCGAATTAATTAGCAATACAACGCCTATATTTCGGCTTTGTACGTTTTTTAGTAGATCATCTTTT
TATATTAGCCTTTTAACACTAGCAAGCAGTGCTTATATATGAAAATAATCCGGTCGGTGAGTGTTGCCATGGAAATTTATTATAAGCTGCCTTGGTCACC
GCTACACGCTCCATTTCGTCTTGTAGTTATTCCCTGATGCAATGACAGCCCTTGCAGAAGTCCCCACAAGTTTTCGATCGATTTATATTTCCAAGAGTTA
ACAGAACACTCCATCATACCGATTTTTGGCCCCGAAAATCCTTTAAGACTTCAGTGCTGTGAGTGAACCCAGAAAACGCTATAAATGCGCTAATGATGAA
AAGTAATCCCCAAGTGCTATAGTGCGAATTACTGCATTCTGATGGCCCTCCAGAAACTCTAGATCGGAACATCCTTAGTTACTGGAGGTACCCCACACGA
ACATGATTTAACCAACATATTGCCGGCGTAGACAAATTGTTTAACGTGTAGCGGATTGCGCGAATATTTATGGAATTCATACGGTCCATCCAGAATAATT
CTCTTCTCATCCTTACACATTACAGAGTTTCTCGTGTTGCCATAACCCACGATCTCAGTCCCCCAGTCAAGGCGAGCTATTTGTGTTATCCTATTAGACT
GGACACCCCGCTCTCTTCTCGTAGCGCTATTTGGTTGTGTCATGCAGTACTTCTTGCAAACTTTTTCTAGACACGGTATCTACAGAATGTACATAAGCGA
TCTAGCGCTGTTTCCGTCTTAGAGGCCTCCCGCTTCAGTCGTCGCTAAGCCTTATCTGTCAGCTTCTTCGGCTTTCCAGGATTTGGCTTCGTAATTTAGG
TGGCGGAGTCACTAAAAATACTGGGACATCCTACGGGAGCACCCGTGATGTTTTTGTAGGACTTTTTTGACCGCGCTCGAACGAATTTCGTGAGCGATCC
AGCTCTGCTTATATAATATACTACCACTGATACCGCAAAAGTGTGCCTTAACAATATTAGAAAGCATTCGTAAGACAAAAAGACACATAATGCAATCAAT
TTAGCTAGTAATTCTAACTGCAGTAGCACGTAAGTATACCTTTCCTACCGTAATCGTTCAGTTGGTGTGCCACGCGCAAGATATTTTAGATACAAAGGTT
TTGAGCACATTACTAAAGCCGCCTTCGAACCCTTTTATTAATAAAGTGCTAATAAAGCGGTGTTTACTTTAAAAATAGAAATTGTTAAAATTTCTCACTC
TTTGATTATATTCCCTTCCCTTTTCCATTAAGTATACAGTTATATCAGCAGATTTGATGTCTCAATATTATGTGTCAATAAAAAAATTACCTGTTTTTGA
TTTCAAATACCCCGCAAGCACTACCACTCCCACGACTAAATGGCATTGGCCAGGAGACTGGGGATTTTTCTACAGCGTGCCAATTAGTTTGAAGCCTCCA
GGTGGGCGTAATAGTTTTAGCCCATACTTGCGAGTATATGGTACAAGATAATAGCGAACGTCATACGATCATATATTGGTTCATCAATTTCTCTACAGAC
CGGAATTTAGGGCGGAATTTGCATTATATCGACCAACTACGCTGGCAGGTATAAAAAGATCAAGAAAGTCACGTGCAAAGTTAAATAGCATTTACCGTAC
AAGCATTGCTTCTCAACAGAATAAAAAGATAGAAACGAGATGGCGATGGATACGATTATAATATATTACATACAATTACATACAGATTTAGCAGCATCAA
AATATAGTTCACAAGCCGAAGAGGATTCTAACATCGCGCAAAAAACTATCTTTGCTTTTATCTGCTGATCAGCATTTTTAAGCAGCTGGACGAAGATATA
GCAAAGAAATTATCTCTTGCG