Description :
From Genome Similarity Track
Location :
contig_72:40078- 41649
Transcript NameFunction/comments
g11521.t1hypothetical protein

Sequence
1571 bases(100 bases per row)
TTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCT
TCCGTTTGGTTCTTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACAGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACAC
GTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACATACGCTGCGCCAGCTCTGAGGATGAATTTTCATGCGCGGCAGTCACCGCCGCCGCCAATTG
CTGAGTTAAGCTGTCGATTTCCGCGTGTAGACGCGCGATTTCCTCCGTGTGTACGTCCTGCTCAAGACGCAGCCGGTCACGGATAGCAGCGATCTCGCGC
GAATTGTCAAGGCGCTCTCGCACCACACACTCGAAGTCTGCAGCCAGTCGCTGCGCGTCTTGACAGCGGCGGTAGAGGATGTCGTATTGGCGTTGGCAGA
ACAAGACGTAGGGGGACGCGTTGGCATACGCCGCATCGATTTCGCGCTCCAGGCGATCAGCCCGCTCCCGTTGAGCGACATACGCGCGTTGGAGGTTTGC
ATGATCTTCCTCCAGGTTTGACTGAGCGTCGGCGCGAGCTAATAGGTCCGCGAAGGTGTCCAGGAGATTGCGGGCCGCCCCGCGATCGACGTGCGGGAGA
GCGATTGAGAGAGTCGGCACCACCGGCGAGCGAGGCTCAGCTGCTGCTGCGCGATCCGGAGGAACTGTATTGGGAGCGCCCGAAGTACTAGGACGCGTCG
GAGTGCTGGAACCGGAGGTTCCCGGAGTGCTGGGGCGCGTCGGAGACACCATGTCGGATCCGGGAAGCGGTAACGAGGGAGTGCGAGGCGGCGAGTGGAG
TTGTGTGTGCTGGACCCGACCGCCGTACGGCCGTGCCCAGTACAGGGGGCGATTGAGGTGAAGCGACTTGCCAGTTGGAGAGATTGAGCGATTCGGAAGA
GACTGATGGCATGAGATCGCGTTTGGAGGAATCGCGATGGAAAGATTGCGGATGTGTCCAGTTATGGCCAGTTGTGTACAGTGGTGTCCAGTTATGTCCG
GTTGTGTTCAGAAGACATCCACCCCCCGGATTGAAGTGGATACATGTCGACCTGATGAGTATGGCGTAATCATTTATGCCGACCTGATCAAGATCGATAT
TGAGCAATCATTTCGATACGCAATCTGATCCAGATCGGCATGCGACAAACATTTCGATACGCGATCTGTACTCACGATTATTGTGGGTACAATGGACCAA
TCTTTTCGACACGGTACCGCGATCTTGGTACATCAGACCAAGTTCAAGCTACGGTGTGCAATCAAGGGATGCGCAAGCGGGATAGGGAGAGAGCAGGATA
GGGAGAGATCTTTAGGACCTTTACTTTTGGTTAAGAGATTCAGATTTGCCTTGCAAGACACAAGTGGCGTCCATACTTTCCGGGGAAGGAATTACATTGG
CCTACCCGACGAAGGACCCACCCAGTCGACCAAGGACACGACGCAGACCTGGATAGCTTGGCTAGGGTGCG