Description :
From Genome Similarity Track
Location :
Scaffold_67:40075- 43019
Sequence
2944 bases(100 bases per row)
AAGAGACGAGAGAGAAGAACGGTCATCTCAGCGCAGTTGCGCGAGTACTTCTGTAAGTACGCCGCTAGACCAAGGGACTTTCTTAGTCCCTTAACTTTGA
CTGACGGTCCAGTCGGTAATCGCCTTGATCTTTCCGGGATCAGGGCGTACGCCGTGTTTGCCAAAGATGCACCCAAGAAGTGGTATTTCTCTAGCAGCGA
ATATACACTTCTTGAGGTTGGCATACAGCTTATGCTTGCGCACAAGTGTAAGAACCTGACGAACGTTCTATGAACCTCTACGTCCGTCTTTCCACCCATA
GCCCGGCTATGGACGAATACATCGTCGAAGTAACTCGATGCGAAGTCTCGCACCGGTCTCATCAGATTTGTAACACATCTGTTGAATGTGGCAGGGGCAT
TGCTAAGCCCTTGTGGCCATACTAGTCACTCCCAGAGCATACCGCTCGGGATGCTTACTGCCGTGTAAGGGATGTCCCGTTCACACATTATGATCTAATA
GAAGCCATCCATCAGATCCATGGACGAAATGATAGTACTCTTTGACATACCATTAATGATTACGTCCTTCCTCGGTATCGGCATCTGAGCCGGTACCGTT
GCAGCATTAAACTTGTTGATTTCGTGCATTTTCCGCCATCCTCCTGTGGCCTTGCGCACATATAAGGTCGGAGAGCTGTGAGGGGAAGTTGAATCCCTCA
CATGACCAGCAGCTAAGCGATCGGCAAAGAATTTGTCGATCGCAAGTACTTGTTCACGAGGCAGTGTCCACTACTTCATGACACAGTACTTCGAGCCCGG
TTTGAGCTCGATTTCATGTCTAGTGCCTTTATCCTTAGGTAATTCGCATGGTACGAATTCAGGGAACACGTCCTTGAAATCGATCAAATCCTTATATAAA
GGATTTGTCTGAAGCGACTCCCAAGATTGAGACGTGTATCGCTCAATCCGAGTCTTCTCATCGAGGACACTTTTTTCCATCGATGAGCTGGCTGAGAACC
CGTTCGTTCTCAGCAAATATTACTGCCGACACAATGTCAGTCACGTCCTCGTCCTCCATGACGAGTACACAGATCTGCTTGACCTTGCCACTATGCAGAT
CTCGCAAGAACCGTTTCGTTTCTAGCGTTGGCAATTAAGTGATCTACCAAGTCAACATCAGAGGCGCGATCAGATCAAGTGTATAAGCGCCTACACCTGA
CCCGTCATTAACCAAGGCATTCAATGTCTCGGTTTCTTCCTGGGAACCCTTTTCCACAGGCTGCTGAGGACTCATTCCCTCAGGCTGATGAGGTCTCGTT
ATCTCATCAATAACTTCTTGGGGAATTTCTTTCTCAAGTACGTGAGGACTTATTCTCTCGACGTCTTCTAGCTGGGGTTGCGCTATCACAGCTAGTTCCT
CTACGATCGAATCTCCAGCCGATCTAGGATCATCGTGTTGCCCTGTGTGGGCAACTGGTTTTATTCTTACTTGGATGTCGCCCGCTAGGCGTATACCCAT
GTCCTGGTCCACTCGACTTGTTCTATTGGTGGACCTTCGGCGCTGCCAGTGCATCCGCACAGCCGCCGGCTGCTTCCTCCACATAGTGGTTGGTTGTCAC
ACTGTGATCTTGTGCAGTCTTACGAACGACCGTACCACAAGTGAGGCCATCGCACTCACTCGCAGTACTTCCACACGCTTATGGACGCTCCAAGACGTTT
ATCAGGTGGCTGGCATTTTCACGGATGCTGCCAGCTGACCCTTGGCTCGTACCTTCTGAGCCAGGGTAACCCTAAGAGACATCAAATCTATCATCCAAAT
TAAGTACGATGAAATCATCATTGTATTGCAAGTCTTCTAACGTGTAGTGAAATCCCACAACACGTTTCATGACTGTTATCGATGCGCCGGTTGCGAGGCG
CACCGTCAGCCTCGTAGGAGGAGTAACGCGCTCAACATACTTGAGCCTACGATCTTCTAGCGACTGGCGACGAACAAAATTGTTCGACGCCCCACAGTCA
AATAAGGCACGAAGTGACATATCTTTTGTCACTTCTAAATTCAAGGTGATGAGGGGTACCTCATCACCAAGTGCAGAGACACACAAGGATTATGAGTCTG
GATCAACTTTCATCAATAGGTTTGCAAATTCTATTGAGGTTGCTGGATCGGTAGGGCGCTCCGCCCCTACTGACCCCGACCGTTTGTTTTGACGGTCCGC
TACGCTGTTGTGACTTTGCAACAGCGTCAGACCCGCGTCCTTTGCTCATCTTGGCAGACGGCCGATCACTACGCTCAGTGTTACGAGACACTGGGTGTGA
AGCACTACACTAGTAGGCGTAGTGTCCTAACTTCTGACAGCGATTTTCACTTTTGCAATTGCTTACTGCTTGAAGAGCGAGGTCTATCGCTCTCTACTCC
TCTCGAAGGACGGTAGGGGGTCAAGCTAGTGTGAGCCCGTCTCACACTAAAGTCCTCGTGCACCGTATTTGTAATCGCTTCCTCAAGCGACTTCAACTCG
ATGCGGATTAGATGATTCCTCATGGGACCATCTATAAGGCCCTGTAAGAATATCGTGATCAGCACGAATTCACTTACTAGGTTCGCTAGCATGCAACTTG
CAAGGTAACGAACGTGCTGAGCGTAAGCGTGAACGTCATGCTTACCTTGTTTTATCTTCAGGAGCTCTGAAAGAGTCCTGGACTCAGCTCTTGGCGGCTC
AAACTTTTGGCTGAGCAGAGTCTTAAAGACCGCCAACGATACAAACACGTTTAGATCGTGTAATTGAAGATTCAGGGCCCAAGTTCTGGCACGCCCTGAC
AAATTCGATTTGGCAAATGCAACTTGCATTTCCTCATCGTCGATGTGAAGAGCCTTAATGGCATCGTCCACTTCGAGGAAACATCTCAACAGGGAGTCTT
CCACGACTCCACGGTAATTGGAGACTTCTAACTTCAGAGTCCCC