Description :
From Genome Similarity Track
Location :
contig_47:400715- 401901
Transcript NameFunction/comments
g7903.t1hypothetical protein

Sequence
1186 bases(100 bases per row)
ATGGCAGGGTTGCGATGAATGTAAGGCAAGTTGCTCGGGAGGGTCTTGATCTGCATGCGAATTCCTTGCTCCTCATCAATGGTCACTATGCGTGGTGCTG
GTGGGGTGCTGTCTGCCTCGGATCGCGCAGGTCCGTCGGTGAGCAACTTGGCTTCGACGCGCTTCGTGATCGCTGCCACTGACCGAACAGAGTGCACTGA
GCGAATCGACTTGCACTCAGACAACACACTGCTTGCCACACTCATAGCGTCGTCGTCGCCACCCTTGGCATCTGCACGGTCCCATCCCAGCCGAGATAGA
TCGTTCCCGTTGAGAGCGCCACCTCCATTTGCTAATTCCTCAAGACGCTGCTGTTCGCGTTCGCAGCGCTTTTCCTCAGCCTCCTCATAGTCTACGATAG
ACTGCACCTGTGCTAACTGCTGCTCTACTTGAGCAACACGCGCCTTGATCTCCACGTCGTCCATGAACTGATCAATATCCAGGTTATTTGCAAATTCAAT
GAGGTCGTTGGCTTCAGCGTCCTCGAGGCTATCAAGTTTCTCATCAGCTGTGGCCTTCGTCAACGCCCACATAGGGCGATTCAAGCTCTTCTTCTTCTTT
TCGACCGCAGGCCCCACATCAGCATCAAGGTCATCCTCGTCATCGTTGTTGCTGCGAACAGCCTCGCGCATCTTAGCTTCACGCTGCGAAAACCGCTCTC
GACGCATTTGAGCAGCTTCTTCATCTTCAGCGAGCTCGTCCTGCAATCGAGATCGCTCTTTCTGCAAGTCGTGAAGCCACTTCTTGTGCTTTGACAGAGC
TGTGTTCTTTTTGTCGCGTCGAATACCATGCTGCGAGACAAAAATCACGAGTCCACACTCAGAAAATGTACTAACTTGTAGTAGCATTAAACGCACTGCA
GGCTCGCTGAGAATTGGCACGTTCAGGCCGAGAGGCTCGCCGGGGTTACCCGCCAGAAACGCCGCCTTGCTGTTGTCGACCACATTGTTGTTAGTCTTGG
CCCCGTATCGGTTCTCCTTTGCCAACGCTACACCAGCAACAAAACTACATCGTCAGAGTCGCAGCTTTCACGTTCCTTTACGAATCAAGCCACTCACTGC
TCGAGACCCCGTTGAACGGACGATTGCAGAGCATGACGCCCTTATAGTTGCCGATGCTCACAGCCGACGTCGATACGCCCGTCATG