Description :
From Genome Similarity Track
Location :
Scaffold_38:400671- 402688
Transcript NameFunction/comments
Phyra_79292multiple inositol polyphosphate phosphatase, putative
Phyra_79293multiple inositol polyphosphate phosphatase, putative

Sequence
2017 bases(100 bases per row)
TCCCGGTCGCAGGTTTTTGATTAGCAAGTGCCTTTGCCAAAATAATAGGTTTCTTGATGGGGAATACTGGTGCATATTACCTTTAGATTACTATATATTC
TGTTTAGTGATGATGAAGTTGGAAAAAGGATGGCACCTCTAGATATTTTGAGTTTTGCAGGGTATGGTTACGCGTGCGACTTGCGTTTTTTGATGGCGCA
GTCTCTTTTGAAGTTGTAGTCGTTGAGGTAGTAGCTCCATAGCTGCTCCACCTTGGAAAGTTCGCAGTACAGTTCTCCATCGCAACCGGGTAGTGGGGCC
TCGATCTCTTGGATCCACACAGACACGTAGAACTTTTGGTCCGTTTTGCCGCGGTACAGACGGAAGTCCATGTTGGAGGCAGTAGGAGATAGTATCGACG
TGCGGAAGCCCCGTGAATTGATTTGGTCATCGCTCCACGATGCCAACAGCCTGGTACGATCTCCGTACCCGAGCAGTGTCATGAGCGGCAGTGTGGTTTC
GGCGTGACCGAAGCGCAAGTTGCCGACGATGGCTGTTTCACCGGTGGTGAATTTTTTCATGTAGGAGTAGATATCTTGCAGCAGGACGGCGGACATTTCG
TAGTTGATTTTGAACCCGGCACCCTGTTCGTAGAAAGCTTCGAGGTCCTCGGCGTAGTCCAGTCTGTTCAGAAATGTTTGGTCCATGAGCGAGCACCACT
GGTTCGTGATGCCGTACACCATGATGTCAAACCTACGAATTCACAGAACAGTTTAGTTAGTAAAACAGCGCACACGTTCGCGATGTCGATGATAACGTAC
GCGCAAGCTGCGAATGCTGCACGCACATCAGTGAAGCTGAGCGACGCACTTTCCGGCAGGTTCAGTTGCATCTTGAGGTACACTTCGCTTGCATTCATTT
GACTGGAGCTTCCGTAAGCCTTCAACTCTGCAGAAGCCTTCGGGTTGCGCTTGACTTCCGAAAGGTAGCGAGCACAAATGTCGTAGAAGCGAATGAGCGG
GTCCTAGAGCAGCAAAGAAGACGTCGGAACGGATAACATTTTTGTTGCGAAGTGCTCTTGATAAACGTACCTTTCCACTCGCATACTCAACATACTGAAT
GTCGTCAAGGTTATCGAAAAAGGTGCTGGCAAACCTGTAAGAATGGGCAGTAACCCAAACACAAGAGCGCATCATAATCGTGCAGTCCAGCAAGGCTCGT
GGGTTTTTAAACCTACGCTTTGGCACTTTCACCCGTGCGCGCCTTGAACGTGTGTGTAAGCAAGAACTGGCTTGGGTTATACACCGTCGGGAATGCCGAG
CCCACCGACTTTCGGGTGCGTTTCCCATACGCTGCAAGCTCATCAAACCCAGTCGAAGATAGGGTCCCTGCAACTGTAAGGTTATACGGGAGCGAATAGT
CCTTCAACCACTGCGGGATGACACTCGAATAATTCGCCTGAAGCCTTTCCAACAGATCGGCAATCTCTACCATGGTATTGTCGGTAGGAAACCTAAAACA
GGAGATACAGCGCTTAGCGTCAAAAAGAGGCATGACTCAGTATTTTCCCCTTACCTGCTTCCATGACGACTCACCTGCTGAATCTGAAGCAGCTCCAGAT
CTGATGCCTGGATTCCTGTCGACCTTGCATTCGACTGCACAAGGTTTGAAGAAGTACTACGCTGATCCCAATACATCGTCATCGTTCCAAACGAACGAGG
GCTAATTGCACTGGAGTTAGCAGCCTTCAGGCTGTCAAGCTCAACGACGACAGCATTCTTGTCTTCGTAGCCACCTGTGGCTACTAGCAGGATTGTTGCA
AGGACACCTGTGGCAGCCAGGAATCGGCCGATCGTTACCACCGGCAAGGCCGGCGATGAACCTGGAGATTTTTCTCGGTCGAACGCTTCGAAGTTCCTCG
TCATTGGTTCTTGGCACTCCCTTCGCGACAAATACAAACTGCGGTGGTCTCTTTCGCATGATGGTCGCCATGCGCTCTTATCGGTCGTTTCATTTGCAAA
CAATTTTAGAGAGCAGA