Description :
From Genome Similarity Track
Location :
Scaffold_30:40063- 47453
Transcript NameFunction/comments
Phyca_LT153417698conserved unknown protein
Phyca_LT1534507748Hypothetical protein
Phyca_LT1534548715RCC1 and BTB domain-containing protein, putative
Phyca_LT1534548717predicted protein

Sequence
7390 bases(100 bases per row)
cactgggtggtgcactgcgtgaggcgctaggaggcggcgtcggtttggcctgcttgttgcccatggtgaaggtgatggatatcagtaggtctgagaatga
agaggattggttaaattgaacgaatctgtatgaaatctagaaattgaaagaatgtgtacgaacactagaaatccatgtatggcacgtaatcaagcagaaa
tttgacaattaattctaaagaaaatggtggtggtgcgatcatccacgcgcgtgcaggaaggcaacgagatggcggtggccgtgccaagtgaagtggcgga
ggccatcgccatggtgcagagcgattctccgcttgtggcggccgagggcttttccaagctttcgcatgccacgttcaacaaccgtaagttttttttttct
ttttgaacgactggaactcgactaaccgtttaatgaatgggcgtttggatgtgtagcggttggaaaggaagcggcaggagaagcaggagctatcgccgcc
attgtggatgccatggagcgtaacatttccaacggaaccgttcaagaagacggatgccacgcattgcgcaatgtcgcattccactgctgtaagaggggaa
tccaatgggcttgcaacttgataaattgaagagctaatgacgttcttatgttgtttagtgcctaatctggtgctggcgcgggaacaaggcgccatcactg
ctgtactgaaggcgatggaaacgcacccggagaacgaagctcttcaagctgaaggctgttgggcgctgctggtgttctgctccaacacaggtacaatcat
gtttagttaaattgatgcatgctgtaactgaggtgagtcctaacgtcctggttgtcgaattgagcagaagagaacgcagtcgtggccaaatcgcaggtgt
cgctggttcacaaggctgtcgctgcgtacccgacgaatgctgacattcagagccgaggccggttccttacggtgctctttgcgtgaacttaggagggatt
gtttgagacacagggtcaaattttatgacgtagacgtagagcatactacgtagtatatattcggaatacagtattccttgcctgtgtactctgtattgct
ttgcagcagaccggcaattggcctaatacttatgcttgctgcttgaacgacccataacttgcagttccatagccggcaggggcggcgtagaggccgtact
ccgggtgcttgtggcgcttgtggatattctccagttccacaagactgagcacgttggatccaagtcccagcagacaacctgatgcgaagggcaccacgca
cgcttggaatgagaagagaaccgagaacgggtccataaactgcagtgtcgacgacagaaagaagccgatcatagccatcatgttcaagcctgctcagata
acagcacaatgtgagcaaaatttccatatctgtgacgaaaaaaagatctaggagaacctaccggtgacccacgtctcgagcgttgtgaggcgacatgaga
accactggtggacaacctcaacgtgcgccaggtaggcgctgagcaataacaggaacgacccagcgaaaaacggcacccagtagcctacaatgaggctgaa
gtcgtcgcgtttgacgtctacaacgccgaagttctccgtgtcagatcgtacccacacgtacgcacgggcgaagacgtaaagcaacgatccgagcataccc
aatagggcggtccagaagtcgatgcggctcgggaagacacctacgaactgccgttcgagcacaggctccgtgccgtggaaatactcctccagccagatct
cgaggttgtgacagcagttgatgacttccaggtacgtgatcgtgtggtaggcgaggaagaagacagaagcaagaagcagtggtagatccaccgacgagtg
gacctggttgcccggttcacgagcagctttggagccgcgtgcactgtgggcaacagcctcacccgtaaggcccgtgatgaagagcgtgaaggccacaatg
gcgcaaacgccggcccagaagctgagcgagtagattttccagcttttgccatgccacgcgcggtagagcgtagtcatcatcttgcggtgcgcacgggagg
accagacgatgcgcttctggtctacagtgtagaagtccacaagtgtaggtgagaaggcgtccacgccgtaatagaccgagttgacgctgtcaggagcggg
cacaatgagctcctcagaagctactcgggagtaggaagaagacacggacgacgctgtggggctcgtagccgcataaccgccgtgctgcagcagcggcagg
tccttcttggctaccattttgttacgtgtgcgctccgtggtaaattcgagactcgcagctcaccggctgctacttttggatgaggcgatggggtctcagg
cagctggctgcggtctgtctgctgtgggctgtctgttacgggaatctcgaaaccttccgcgtgcgttcgtctggaagagtttaaaattagtttttcactt
gatgagcaccactgcgtcgactggctgagccacttaatatcgcacgagatggacgtgtgtgcgagtgggagagaatttcgaaatggctcgagctgagctg
ctttgactcaaagcctttgagactcgagcggctggtgctggcggctctgcaggatatctttcagctctttggccattgaagcgaggagagagataaaagg
tgcatttcactcgatttcattatggggtttcctgtttcgaaatttgagagggaattttaacttggatatctgtcgacatggtgggcgggtatgcaaggct
gcatgtggccgcgctccgagacagacagcttgaatgctttggacggtcgtctttaaggcaataaggtcgtgcacgaagctctgatgagcacagccggctg
gctggctggctggctcggcttggtgcacagataggggttgcctgaaaccgcagagtttcagcggctcttgcgactgtgccaaaaagaggttgaattcctg
taggtggtccatccacgacgacatggctaaactatttgcggcttgacaaccggtgcaaatgtaagtgaagcctacaccgagtcggtgaccgacggcgtca
ccgtagccgtcgtggggatggagttaatgatgtgctcaagattatctgaaattttagcgcacttcagcttgcagcggctgggccacagcagccgggggat
ggattctgttggcaacgcaaacatcctgacgtaggtcgccatttggctctctcgtcgttgatactgcgccgaggtgaccagcaaggcttgcatcgaggta
catgtagtttagtcgacaagccacatgacgaagcgctatctagagtgacgaaggtgttcaaaactcgtttctaactaaggaccatcatggtcaccattgt
ccatctgaatcagactgatctgagccaaaggtcgttcgacattttttcgaagagcgggaacgttccccgaaaaggcttcctacggtatagataccggtat
tctggcttggagtctgaaaaatagtagtaatgacagtgctattacgaagagtactcctgcactactaccagtagtatagttcaaaaattaataggacaaa
aaaacactgctatccaaaattctcactgctactgtaccaataatctctgattgcgatccgaaaatatggcatcgaaccatctactggcgcctgccttcgc
gcggtccagaggttcctccagcgacgatgacagcggtggcgatgagcttgcaggcgtttacagctttggacaggtgcgcgaaagcacttcaatctctcaa
agtcgctagtcaaaacattgaattcttaccattgaaaactacagaatacgtacggggagcttgcgcttggcgataacatcggccgtagcaagcccactcg
cgttgatatcaatagtatcggtggtgacaaacgggttgtggatgtagcttgtgggaatgagcagactgccatgctatttggtgcgttggcgtcactgtgg
cattgtttcaactttaggtttattgatttgacttgcatgcatagagaacggggacgtgttcacctgcggatataatgacaggtgcgccgactttgctgtt
tgtgatgctttaaggaatttacttttaattgagattggtattttgtagtggacaatgtgcaatcggcacgacggaacgtgtccccacgcttcgatactca
ccgggtcttagctctgttcgcacggtgaagattttctcgggaaatggcagtgaacaccttgcagctctgagtggttcgttgtttttctaacgagatcgga
catgacttgctaaccatttgaccttgcagccaacggaaacgtatacactgtcggatttaatttgcgtgggcaattgggcctggattcagcaacgagtgtt
acggaggcgactctggtggataaattggcagggaaacgcgtggtagatgtggcttgcagttactttcacactgctatcgtcttggataatggagatctgt
acacttgcggctgcaacgactacggccagctaggcttgggtgatcacagcggacaacttgtgccacgaccggttgaaagcttatttcgacgccctgttct
agctgttgcttgtggtcaacattacacagtcgcatccttgagttcctgctgtgtggtacaaatatgtggtgaatattttttaacgtgttttcttgtgttg
ttttatatgtcaggggatggaggagttgtagcatttgggaaaaatgaccacggccagcttgggcttaacagagtttccgagccagttttgcaacctactc
gtctaccgccgccgttagatagagcaatagttccccagctttcgtgcgggtatcaccacactgccgttgtcatggagagcggtgctgtgtatacatttgg
acgcaacgactacggtcagcttggtcttggccacaaacaacacacgccgcgaccaacggtttgttattcatatttaacgtgtgtgtgcgacttactgagg
ctttaatgcactgcagcttgtagaaagtttgtcacggacgagaattacccaggttgcatgtggttgttatcacactcttgctctttcggacgatggaaaa
gtattcccgtttggtcgcaacaaccacggccaacttggattagaaacgtcggtggattgtttaagcccgcagttgatctcgactctacggaataaaaacg
tcgtcaaggtaagcactcaatgaatcaactgaaagttatgtcactattctttttcatgtatttttcgtgataactgtagattgctgccgggttctaccat
tcagtctgtgtcgttgggatgtcggaaggcgagaccttagccaaaggctctgggacattaagccaagacttacgaagaatgctcaacaactctactcgaa
gcgatgtcaccttcgtggtagaaggccgcccacttttcgcacacagttgcatcttagtagctcgttgcgaaccactggagaaaatgctggatgggagaat
gaaggacggatcacaacctgaaatcataatcccggagtattcggtacgcggaactgttctgaagtaatggggtggccactaattctttcttgacagtacg
atgtgtttgcagctttaatggagttcttgtacacggatcaagtggctgcgctagcatcactggatttgacggcaggtaagggccaacgtcggcgtcaatt
gccttcttctaagtatttaacttgtgtatgaatgtcttctcagactttgctctcgaattgcacgcacttgctgatcaatacctagtcgcgcgtcttcaaa
ggtacgtcacgaattgctagctgaaatcttggcactgtcctcatattttttgtctcgtattttcaattcctgcagcgcatgtgaaaacgctttactgcaa
attctatcagtggaaaatgtcgttgtcattatggaggtgcgtttggatccttggtattcttttgttattgtacttacgcatttatactatgttttaaatg
tactgtagtcggctcacttccgtagtgctttcacactgaagaagcgatgtctcagcttcatcatggaccatttcgcccgtgttattgcgacacaggtata
gtctgctttcctcgacatgtattactagcgttgggtagtgttctcattgaggtatgctataggcttttgtcgggctcccacaagagctactccaagaagt
tctgcttttggcttcttatcaaggagtgtcaattcccaaccaggttaacgctggcgacaacatgcagtgactccccccgctgaatgttgccatattttta
cagcacaaacgtggaatataaatcaagttatatgttgcagagaacaccactttactatctttcctgtcggggaagtaccagacgtctgctggtctcaatt
catttcggtcagcatgcttactggcgactctaagtaggttttccattggttcgagaaacgtgccattgttgcgccgtcaatcacgcggtgatcaccgctc
cacgacacattcatcagacgcacaggttgaacgttgccgtctgcgtcataccgaggaagcttctggatccgaccaatagctccgatagccacctgaggaa
ccatgagaacgggactcatgtatgtaccgccaatacttccaatgttggagattctgtgaatatgaacccggtgaataaaatgctcgcaagaacactcgta
aagaactaacacaaatacttacgagaatgttccaccagtcaggtcagcaggggtgagtttcccggcgacggccagttgctgcagccgattaaggtcttca
gcgatctccataatgctcttcgcctgtaggacaaaatatgtggggttaatagcagtccagcaacgcttttccaaatggaccggcatacctgaacattctt
gacgtttggaacaatcagacccgtcggtgtgtccatggccaatgaaatgttgtgagcggcaaccaaagtaagttccgtctcggtatcattcactgtcgcg
ttcagcatcgggtagtgctttaaagccagcgatgcagccttaatgatgaaaggcataaacgacagcttcacaccacgggcctctgcgagcggcttcaatt
ccttgcgcagatcatacagagcgtccatacgaatctgttttgacacaacccaaattttaacatcgtacacagaagtcatcgagctcacacaaatacacat
cacctcatcagcatatccaaagtgagggatgtttagcgctgcgttcattgacttgaccatcattttctggatagctattcaaacaaaagtatcgttagta
caaaaacaacaaatggtttaaaaaacaccgtacgtgtcagtggcaccactgtatcttgctgcaaatacgttgcattggtcccatccactg