Description :
From Genome Similarity Track
Location :
Scaffold_98:40058- 41501
Transcript NameFunction/comments
Albla_Nc14067340Ptype ATPase (PATPase) Superfamily putative

Sequence
1443 bases(100 bases per row)
GAATCAGATTGTCGATATTCAAACTCGCAATTTTCTCGTCGTTCGCGTTGAGATTGTCGGTGTTCCCTTGTCGTCCGATTTCAGAATTCCGAGAGCAAGA
GTTTTCATGACGATTGTTGAGCTTGAGGACACCATCAAAGCTGAAGAGATCTTTATTAGGCTCATCACACTCGACGTAGAGTTGATGCTGTTGGAGAATA
TCTTCAGCGGTGAGGAAATGTTTCGTAAGAGGCACAACACTTCGAATTTTGAGATTGGTTTCTCCGTCTAAATTTGCAGTTTCCACATAACATCGCCCGT
CTTGTCGACTTGTAGCGAGAAGAATACAATCAGCCGGAACTTCCTCTCCATCTCGCAGTAGTACGATATCGCCCACTCGAATGTCTTTCCAAGTAGCTTC
TATCTGCAAAAGAGCCGAATCTTCGCGCATTTCAGCATCATATCGCACCAAATGAGCTGGTCTCGAGTTGACTTGTTCATCTGACTTTTTACGCCTCAAA
TCTTCCGTAAAATCTTTGATAGCCGATGTCGCAAATACAATCAGCAGAGGCGTCAAACTTGAGATTGGACTGACTGGAGAGAAGCTGAAGAAGCATAGCA
TGACGACCATTGTTGTGTAAATGTTGGCCAAACGGCTGAATTGCATTTTCAAAAAGACAAACGGGAAGTTGAAAAGTGTGTACTTGCTGCTTTCCACCAA
GTTGGATGGGAATACAGCGTGTTTCTGCTGTTTAGTCGACTCAGAACTGTTATTCTCCTGTGGTTGTTGCCAAGTAGAGTCATCTTCTGTACTCTTGAGA
GAGCGTGAGAGAGTAGATTTTTCTTCTCGATCGATACTTTCCCGGCAACCTACGACGATCACTCGACGCGATGCTGTGTGATCTGCTTCGTCTTCCTCTT
GATCGGCACTTTTCGTCAGTCGACTGAACGCTCCATCAAAAGACGAATTCAATTGTGCATCTGCTGGAGGTACCATAGTGGCTAAGGCAGCACGATCAAA
CTCGCGCGAGGATTCTGCTATTTTGACAAGACGACGAAGTTTCCAGCCATAAAGTAGTCCGCCGATATTGAGAAAGGAGAGAATGACAGAGAATAGACTC
TGCATAAGTAAAGCAGTACCCTCACTGACACTGGTCAGCTTCCCATTATATCCTTTAAGATACCATATCGCATCGATCAGTAGGCTCACTTGCATACCGA
TTTTGTAAAGCAGTAAGAAGCGAGGTACAAGGAACTTAGTTCCATGCCATCCAAAAATCAACGTAATGTACTGCACAAAATCAAAAAAATGAGCCAATTG
CATCTAAACATTTACGAGTAAAAGCTTACCAAGATGACCACGGGAACAGTCGATCGATACGAGACTCCGAGTAAAATCGGGATGATCCTAAAAGTACAAA
TGCCGGCTTGCCATACGATAATAAGCTTGAGCCTCCTTCTCGT