Description :
From Genome Similarity Track
Location :
Scaffold_89:40051- 44608
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_89-fgenesh-gene-0.7Conserved gene of unknown function
Pytve_DAOMBR484fgenesh_masked-pve_contig_89-abinit-gene-0.85Protoporphyrinogen oxidase
Pytve_DAOMBR484maker-pve_contig_89-snap-gene-0.46Conserved gene of unknown function

Sequence
4557 bases(100 bases per row)
TTGGCTTCGACGCGACACAGTCCCGCACGCTTCTGTCCCGATTCACCTCGGCGCTAAAGGAGGCGACTGGTTCGTCGACGACCTTCACGCAGGAGAAGGT
GCTGAGGCCGTGGGAGGCGTTCGGTGGTTCCTCGTCTCAGTATGACTGTACCGCGAAGAACTTGACGGACGACTCCATCCCGATTTGCTACATGGAAGGC
ACGTGCGCGTCAGTCTCCAACACCACTGACACGGTTGTGACCAAGTGCAAGACGGCGTACTCGAACGTGTACTACTACCTGCTGGCATTCAGCAAGATCT
CGTCCTCGTTGGACGAGATGCGCGAGGATCTTCTAGGCGACACTGGCATGTCGTTCTCGTCCGGGTGGGCGTACGACCTGTCGATCCGAGAGTTCGCTGC
CACGTACGTGACGAAGCTCCAGGCCGTCAAGACGAACACGATCGACCCGCTGCTTGCGACCGGCGGCGACGTGCGCAACGTTCTGCAGTCGATCGAGACG
ATGCGGTGCTCCGAGAGCTGCGGCTGGATCAACATCTCGTACAACGCCGTGTACGACTCGCTCTGCAACGACATCCTCGGCACGACGCTCGCCATCTCGC
TCTGCGTCTTCTTCCTCTGCCTCTTCCTCATCCCCATGATCGTGACGGCCATCACGCTGCAGAAGCGGCTGCGCGGCGTCAAGAAGGGCACGTACGAGCA
GCTCGAGAAGCGCCTTCAGGAGCTCGAGACACGCAGCCGCGTCAAGGGCCAGGTCGGCGCGGGCGGTAAGGGCGGCAAGATGGTCGACCTCTTCAAGTCC
AAGCTGAACCTCGACTCGCCGTGATAGACTGGCGGCTGGCACAGTGCGTACACCAGAGCTTCAATCAGTGCGTGTGCGAATCAGATATTTTTTATCCAAT
CCTGCGGTAGTTTGACTGCACTGCGACCTTCGACACGAAATGCAATGGTTGTTGAAGTTGCAGTACCTTACATCTCTCAGACATTTGTCGTTGCAGACTT
GAACCGATGGCATTCAATCTGGTCTTCAGTATCGTAAGGTGGGGTACTCAATCCCGGAATCCAATCGTCTCTGCTTCCAGAGTCACCTGCGAGACACTAT
CACGCCTACTAAAGCCTCGCGATAGTCACCAAGCGTGGGCTTTTGCACGAAACAATTGTGTGTCCACAGCATCGCTGCCCTGCAAAATGTTGACGCACTT
CGGTCTGATCACCACTTCCAGTCAATTCGTCAGTGAATACGCTCTCATCAGCTCTGACGACGAAGCCGCTTTTCCAGCCGAGAAGCGAGCAGAGGAGCGA
GGTGAGCGTTGCTATGATGGGTCAGCCGAACAGAATCGAGCTCAAACCAATTTGATGGATGTTGACAATGGAGACAAAATGCAGGTTTTCACCCAATACA
GCGGCATATGCATTGAATACGCACCGGTGATTCGATGAAATTTGCTGCCATGCGTTTCTATTGAAGTCGTCGGTGCAGACAACATGGACCGATCTGCATT
TCTGGACACGCGGCGCCGCGTCTACCGCTGCCGCTGCCGCTGGCCCCACAGACCACCAGACCGCTCAGCATGCCTCCCGTGCCTGCGCAGGCCGCGCGCG
AGGTGGTGGTGCTCGGCGGGGGCATCTCCGGCCTGAGCCTTGCCTTCTTCCTGCGCCAGGCGCTACAGCAACTCCCGTCCACCCTGACGACCGCGGTCCC
GACGCGCATCCGCGTGCTGGACGCGGCGCCGTCCGCCGGCGGGTGGGTGCGCACGGCGAAGAAAGATGGTTTCCTGTTCGAAGAAGGCCCGCGCGGCTTC
CGTCCGTCTCGTAACGGGGCCGAGATGTTGCGGCTGGTGGAGCAGCTCGGACTCGAGCAAGAGATGGCGGCCGTCGACCCGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCTGCGCAACGGCCAGGTCGAGGTGAGAGAGATAGTCGATACTCTGGTGTGCTCTATCCATGCTCGACTAATGCGTTCGGTTTTG
CTCAATGGGAGTAGAAAGTCCCAACGTCATTGCTCGAGGCGCTGCGATGGCCACTCGCAGGTCAGGTCGTCCAGGCAGGGCTGCACGAGCTCTTCGCCAA
GCGCGGGACGGTATGTACAGTCGGTAGCCACACCACTGCAATGCTTGTGGGATGGACAATGACGAAGGTATTGGATCAATGACAGCTTGACGACGAGTCC
ATCTACGACTTCACTGCGCGGCGGTTCAGCCCAGTGATTGCCGAGCGACTACTGGACCCCATGGCGTCGGGTATCTTTGGGGGCGACATCCGCTATCTGT
CGATGCGTGCATGCTTCCCGATGCTGGTCGACCTGGAGCAGCGTCACGGCTCGGTCGTGCGCGGCATGCTCTTTGGCGGCAGCAAGGACGACAAGCTGCT
GGACGGCACTCCCAAGTCCGAATTCGTCCGCCAGCACGAGAGATCTGTCAGCATCAGCTTCCGCGACGGCATGTCGACGCTGATGAACGCCATGGAGAAG
CACATTCGGGTGAGGTTTCGAGGTAGATTGGAGTATGGCCGACTCAGCGTAGACTAATGATGTGCCCTTGATTCGTCACAGGCCGACGCTCTGTCCGAAG
TGCATGCTAATGCAAAGGTCACGCGCATCGATCCGACTTCTTCGCAAGATCGGACGTCATTCGTGGTGACGACAGAGGATGCTGCGACCGGCCAGTCCGA
GCAAGTGGAGGCGACTCACGTGTTCTCGACCATTCCCGCCTGCTACCTGGCGCCAGCCGTGCGTGGCGCGCTGCCCAAACTCGCTTCGGCGCTCGACGAG
ATCAAGTTTGTCGACATGGCGATGGTGCACGTGGGGTTCAACGCGCGCGTCCTCGCGAGTGACGGCTTTGGCTACCTGGTGCCGACGGCCGAGCGCGAGC
GCGTGCTCGGAGTCGTGTTCGACTCCAACACTTTCCCAGTCCAGAACGCGTCCGACAATGACGAACAGACCCGAGTGACTGTCATGAGCGGCGGCGCTCA
CTTGCCCAATGTGCGGTCGATCCCCTCCGAAGAGCTCGAGGCCACAGCAGTGGATGCGCTGCGCCGCCACTTGGGCATCGAGCGCAAACCCGATTTTGCG
CGCGTGCTGACGATGCAGAACGCGATTCCGCAGTACCATGTCGGGTTCGCGAAGACGTTGGGCCGCATCGAGCAGGAAGCCGTGCCTGGGCTGTACCTGG
GAGGCAACAGTTTCTACGGCATCGGCCTCGCGGACTGTGTTACTCGCTCCAAGGAGCTCGCACTGAAGTTCGCCAGCTCAGTGGCGAAGTGAGCAAGGTT
CAAGGGGACAGTCTCAGATCGGATCAGTCAACCACATGTACTTAGAAATTGAGTTTCCCATATCCTTCACATTGTTTTCTCTAGACGGAAGTGCTAGAGC
TAACAATTTCCATTTTGGTTGTGCATGGGATTACCTGTAGCGCTTTGACTGTCTATGGGCCATGGGCCGTCATCACCCATGGTAATGAAGGTGTTTAGAA
GATCGACAACATCTCACTCGTTTTTCGTACCAAGAATGGAGCGTTTTGAGCATCAGATGGTATCAACACTGTGGTTTGACGGTAACTGCGACTTGCATCT
GCACTCGCAGACACTTGTCAAAGCCGAACAAAGACAGTTGGGGTAATCGCCGTCGAGAGCAATGAAACTTGGGTATTCATCAATCATGTTGCGTATCATA
TAGCTCAATCGTCGTCGCAAAAGAGAACGGTCTTCGCCGGAGGGGACGAGTTCCGGCCGATGCGTAGATTGTCACGCGAGTACTTGCGGTGCATCAAGCT
TACAAGTGTCTTGAGCTGATCAAGCAGCATTAACACATGCTTCCAGTCAAGACCCATGGAACACCAAATACAACGTGACACAACAAATGTACAGTACCTC
GTGCCACTTGGCAGACATGGTCGACTTGTGCGCACTCGTCAACCCGTCGAGCTTGGCGAGCATGACCGACATCTCCTTCGGCGTAAGGATGTTCAGGAAC
GCTTGCAGCGCCAGATCCATCAGCGCGACCTTCTTGCACAGCAAGTCGAACGGCGGAGCCGTCTTCTTGACCTTTTTGCTGTCTTTCCGCTTCTTCTCCA
CGTACTTGATCGTCAGGTCTTCCACGATCCCGGCGACGATGTCAAGTACCAGTCCGCTCTGGATGGGAAACTTCAGCGGCCGCTCCGACGATGCCTACAG
TGTACAATAACAGCTCAGTCAAATGGAATCAGCCACCAACACAACAGCGATTGCTCGAACGCACTCCAGGCTCATGCTCCTTGTCGATCCGATGCTGGAG
CACGTATATGGCGACTCCAGTTGTCAACTGTGTGCCGCGGTTCGTTCGAGGCAGGCGCCGCGCCACAGCAAGCCATCCCTCGGCCGAGCCAAACAACCCC
TCCTTCACACCGGCGATGCGAAGAACAATCGTCGGAGCCCACTCCTTGCGCCATTCCGTCGGCGGGAACACGTCCAGCAGTTCCTCCAGGCAGATCGTGG
CCAGGTCAACGATGCTCGGGTGCATGTCGCCTTCAAATTGCATTCGGAGGAAAAACA