Description :
From Genome Similarity Track
Location :
contig_120:40046- 41918
Transcript NameFunction/comments
g13929.t1hypothetical protein

Sequence
1872 bases(100 bases per row)
ATTGCTTGAGACGGTCGCCTCTAAACGGAGGGGCCCTGGAGCGCGCCGCCCGCGCTTTGCCTACCTGTGGTGCTCCGTATCTCGCCAGGATACAAGTCTC
TGCTGCAACGGCAACTTGTTGCAAGCAGGGACATGAGCTCTCGAACTCCGAGTCGAAGCTCTAATCCCTGGCTCTGATGCAGCCAAGTTGGCCCGACACA
GGACGCTTGCACGGACACTTGAGCCTAGTATGGTTACCTAAAAAAGAGCGTCAAACGCATCGGCTCTGTTCGAGCGCCGTTCTCACAAGGCAAATCTGCA
GCGGTGGACGAGTGCGAGCCGCATTAACTCGCTCACTTTGGAAATTTCTTCTCCTAGAGAAGCCCAGTAAGCAGCGCCGTCTTCCTTCGTCTCGTTCGTT
CCACGATGTCGGCCGCCAACGGCAAGACTGCCTTCTTCACGATGGAGGACGCCAAGGCGTCCTTCAACCTCTTCTGCTGCGTGTGCGGTATCGGTTCGCT
GGCCATGCCTTCCAACTACGCTCGCGCTGGCCCGTTGTATGCGTCTATCGCGCTGGCCTTCATGATCTTCGCCAACACGTACGCTACGCTCAAGCTCTCC
AAGGTGATGCTGGTGGCGCCGTCGTCCGTCAAGACGTACGGTGACCTAGGCGAGTGGGCCCTGGGCAAGTGGGGCCGCTTCTTCACGGTCGTCTCTCAGA
TGGCGTCTGTCTGCTGGTGCCGATCGCCTTCCTGGTGCTGGGCAGCACTCTGCTGACGTGCTGTTCCCGGATTCGTTCAGCCAGATCTTCTGGATCATCT
TCATGGCGCTCATGGTCATCCCAGTTTGTCTAATCCCGACGCTGAAGGAGAGCGCAGGCATGGCGTTCGCCGGTTGCATGGGCACGGTCATCGCCGACAT
CATCGCCGTGTCGTGTGTGCAGTGGAACATGCGCGGCCACGGTTCGATCCCGTCGCCAGACGTGACGCTGCACCAAGTGCTGACGTGCTCGGTAACCTTG
CTTTGGCGTACGGTGCTGCCATTGTCGTGCCCGATCTGCAGCGTGAGCACTCGCAGCCGCAGCGCATGCCGCGTGTGGTGGTGATCACCATTCTGTTCAT
CTCGGCCTTCTTCATCGCTGTTGCTCTGGCTGGTTACACGGCCGGTGGCTGCCAGCTTTCGGGCAACATCCTGTACTCGATCGTGAGCACGTCAGACCCG
CTTGGCCTGGCGCCTTTGGGCTTCAGTGCCGACCGCGGTGCTGTGGTGATGTCGTACCTGTTCATGCAGGTGCACATCTCGATCGCTTTCTCGACGCTCA
TGATGCCGCCGTTCTACATGGCGGAGCGCCTCATTCTGGGTATGCACAAGGGCCCCGAGATCGTGCGCTTCAACGGTGAGGCGGACCAGGCGAACGTGGA
CCTTGACCTGGAGATCCAGGAGAAGCGCTCGTACATCCAGAGCTCGACGCCCATGGACACGGCCAACCGCCAGGTGTCTGCTTCGAGCTTGGTCGAGAAG
TCGGAGGGCCGTATGTCGCACCTGCGCGTGGCGCTCGAGTTCGGCGATGAGATCACGGCGGAGCAGCTGCACGAGCCGTACCGCAACAACCCGCTGCGCT
ACATCGCCCTGCGCATTTGCATCATTGTGATTCTGGTGATCATCGCCGTGCTGGCGCGCAAGCGTTTCCTGGACCTGGAGGACTTCACGGGCGCCACTGC
CACACAACGAGCTGCCTGCTCATGCCGCTGATCATTTACCTGCGCGTGTTCTGGAAGAGCATGTCAATCCTGGACAAGGGTGCATCGATGCTGGTGATCC
TAGTATGCGCGGTCACTGGTTGCTACGTGATGATCCACGCCGGTAAGCAGCTCTTCACGCCATCGGACGACG