Description :
From Genome Similarity Track
Location :
Scaffold_211:40042- 44867
Transcript NameFunction/comments
Hyaar_Emoy2812652hypothetical protein

Sequence
4825 bases(100 bases per row)
CAGGTCGTTGAAAACAACTCTGCTCCGCCTACGGTTAACTCAAGTGCTTACACTGCAGTGGATCTCAATGGGGTCCCTCATGAACTGAGTAATGCAGCAT
CGAAAGCCGGGCCGTTTGAATCGTTCGCGTTTCATACGTCGAGGCTGCTCAACGTCGTGAGCCCAACTGAGAAAAGAAGGACAGACTTCTCTCCTCCGAG
CGTTCCAAGTTCGGAGCAAACACCACTGGATCTTACTGATGAAGCCAACGATGGCTCGATTTACGCAAGTTGCAGTAGCAGTAAAAAAGTCGGTTCGCCG
CGAAAAAGACCCCAGGAACCCAAATCAGCGAAAGCAGTAACAATGTATGTCCCAGGTACGTCTCCCATCGTATCGGAAGATGACATATCCGAGAATGAGA
AGCTATCTGGGACCAACAGCGCTGCAAAGTCTGACGTAGCAGGCTTTTCTACTGAGCCCGAATGTGGCGTGGCTGCTGGTATCGAGTCGTCCCATGTTCA
GCAAACAGCTAATATTCCAACACGCACATGTAGTAACATAATGCAACATCGTTGAGTACGTGCACGCTAATTTGTCTTCGCGGAGCCACCCATGACGTCT
GCTGCTCCTGTATGAGGTTAAGTGAGCTGCAAGTAATTTCATATCCTTCGAATGGTTGAGCTTTGCATGCGTTGCTAAGTTGTAAAACAATGTAAATGCT
TCGCAGTGCTTGTGGTCGTCAAATAGCGGTAGGTCACCAGCAAATGTAAAGGCTCACTTTACTAACATTTACACTGCACGTGCTATCACCTCGAGATGGC
TAGAATTCGCAGGTCAGCGATAGCACACCACGGATGGGGCCGGACTACACAAGATTTAAGTTTTTCTAATATCACAGTCTGCCTGTGCGCATCATTCATG
CCAAACTGTTCACGATGCGACAAATTGTACATATTTCGTGGTCCTCCCACCGGGCTCGATTCGAATAAATTTTCAGCAGTAAACTGAAGCCCATGCCTTT
TCACTGGCAAACGTTGGCCTTTGAACAGAAATTACTGCCAGCGTTGACGGCGCCACACATAGAGAGTTTGTTGAGATTGTGCTGAGTCGAAGAAAGTCGT
CACCTGCCTCGGAAAGCAACAACACTTGGCGCTTTACACACAGTGCGGCCACAGACTGGAATGAACTAGAGCAGCTTTTTGGCAGTGTAACAGGGTCACA
CGACAGTTACCGCCCTAAAAGGATGTACCTTGTAGATGTGATATACAATCCCAATTTTATCTGTGAAATAATTGATGTGGTTGATAACCTCAGTCATCCA
TTGATGACAGATTGATGTACCATCCATCAATCTTTAATAGACTGGAGATTACTATGCGAATTAGTTTAACCTTAGTATTAGGTAGTTGAATGAGGTTTAT
TACAGATAAAACTAAGAAATAAAGTTCAGTTCCCCTTTTGATCTTCGATTGACACGTGTCTATTTTAGACGTCAGTAGATCGTTAAGAGTAAGAGCCAGC
TTGTGGCGTATACTCTAGAGCACATTGTGCGTACGATTCTTAGAGTTGTTGTTAGTCCCCTGAACCAGGACTAGAAGCTCTACGAGCTGAAAGACTCTCC
GAGTCTTTGTTGATTATTTCTAAGAACTAAAGACTCTTTAAACAAATAGGAACTTAGTTTCGTAAAACTAAGTGACTTTGAAAGTCGTAAGTCTTCCTCT
GACTAAGAGCTGTGTAACTCCACTACACTTGGTAGCACTTGTAGTCAATCCTTCACCGTGGTCGCAAATCGACTTAACCTCTGTTGAGATTGAAAGCCTA
GCTCATCTCTCTCAAGCTCAACGCCTCGCGCTTGACAAGCTTAGGGCGTTGATTGGTGTCGAACAAATCGACCATATTGTGGCCCAAGGCCCGGAAGTGG
TCAATGCACGGCTGGAAGCTTTTATGCAATTTGACGCCACGTTAATCGGGCAGGTCCATGACCATGTGGCGTCGGCTATGCCTACTCGTTACATCGCTAT
GCCCGATGGAGAGCCTAAGGGTTGCCCATTTGTTCTGAGCGTAAATGGATTTGACGGGAAGGAGGGAGAAAACCTCCTTCTCTGGATTCGAGAAGTCGAA
ATGGCGATGATCACCGCTATGCTGCGAACCGAGCAGCAGAAAGCTGGTCTAGCCATATCAAAACTTGGCAGCAGAGCCAGAGAATGGGCTCTGACGTGTG
ATGCGTCTGTAGACGCCGCGTTTCCCACGTGTGATTCGCTTAAGAGACAGACGTCTCGCGTGTTCGCACCGCCTAATCAGGCTTATCGAGTGCGTTCACG
CTTCTTATCTCCCAACAAGGGAAGAAGGAGTTATCGGACTATGTACAAGAGTTGATAACTCTTCTTGCTGCTATACAATTGGATCCCCTTCCTGAGGAAG
TCCGTGTCACCATTTTTATGGAAGGTCTCCGTACTGGGGTCGCTCGGACCGAATTTTTTCGTGTCCACCCCTCAACCTTCGAGGAGGCTGTAGACATAGC
GTTAAACGCCGAGTTTAATTTCAAAGCGGCTTGCTATGGTACGCATGATTACGCCCAATCTTCGTTTGATAGGGTAGAGCCCATGGATGCCAGTCATGCT
GATGATGACGAAGCAGAGCTTCAAGCTGTGTAACAGCAACATAACATCCGTAGATGTTACACGTGCGGAAGCACAAAGCATCTCCGCCCCAACTGTCCAA
TGCGTAAACCGCGACAAAATCGGCCGAGCCGTAATACCGCCCCAAACCAGAAATCTGGTACGGTGCGGGAAAATGTCGACTCCCAGTAGGCGCGGGGCTT
TGTAGAGGCTCTAGGAGGTAGAGCGTAACAGGGACTAGCCCCACACGATCTCGTGGACGTTGCCACGAAACGTATATACAAGTCAGGCTTGTTGGTTGCC
TCGGCAACGGGTTAAGGGATTTGGAGAGTCGTGGTCAATTTTGATTGACTTTGGGGCATCGGGCGACTATGTCCAACGCTGGTCCCTTGAAAGAAGTCAG
CAGTATGCTGAAGCGCTGAAAGCGCATAAAGGTGATGTTATCACGGTGCGTCTAGCAACGGGGGCCCTTGTCACCATACCTAAAGTTCTGTTGAACTTAG
GTGTAAAGGCTTTAGACTTTAACATCATTGAACGCTGTCTTTCCCTAGATTTGGACTCGATATATGATCTAATTCTCGGTACAGTCTGGCTGGAACGCCA
CGAGCCATGGATTGATTGGAGGTACAAGACCTTTGGCGCAACGCGCAATGTTTCTAGTGAAGCTTTGGAGATTCATGAACCCACCTTTTCTAGACAACAA
AAACGCTATTGGATCGAGACACTGACTGAGTCAGTTAGTGTGCTGGACATCGGAAAGTTTGAGTTAGTTGACTCTGATGTCAATGACAATAGTGAGAAGG
CAAGTACTCCGTTGAGTGGCACTTGTTGTTATAATGAACCACTGGATGCTGATAGCATCGATGACCCCATGTCGATTCATTTAGGATGTGATCCCTTGAC
TTTATGTGCAGTGGCACCTGAACATCCACAGAGTGAGGGCGGCTGCAATAGCACCTCTCTGAGTGTCAGTAATGACATTGCTGACGAAACGCTCCGGCAT
CAAGAGCGGGGCTCCTTCGATGCATGTGCAGCGGCACGTGAGCATTTAAAGATTGAGGGCGGCTGCAATAGCACCTCACTGAATGTCAGTAATGACATTG
TTGGCGAAACGCTCCGGCATCAAGAGCGAGGCTCCTCTGATGCATGTGCATTGGCACGTGAGCATTTAAAGAGTGAGAGCGGCTGTCATAGCACCTCACT
GAATGCCGGTAATGGCGTTGTTGGCGAGACGCCCAGACATCAAGAGTCTGATGTGCGTACAATGGCGGATAACTCGCCGGGTGATGAGTTCGAGTTAAGT
AACTCTGCACCGGATGTAGGTAATGACATCAGATCTTGTTTAGAGTACGCTAAGGCTGATAATGCTAATGAACTTGTAGGACCAGATGGTCCGCCCTCAC
TGAGGAGTTCAGCCTCTTTTCAGATACGGCAGCGACGCCAAATTGCGGCTGCGAGACGAAAAGCGTCTGTAATGTCGCTTAACGATACTAGCGATCAGCT
ATATACATTGGTCGATGGCGTAACAGGTCACGTGGATGGTGAAGTGGGCCTTGCGGCCCTCTCATCATTAACTGCTCTGTTAGAGCTAGAAGAGTTATCT
GTAGACGAGTTCAGTCAGACCTTAAGGGCAGGCGACTTATCCGATATGGTGTTCCTTAGACCCGATAATGAGTTCAACTCCTCGTCTCTATTCGATGGGA
CGGTCCTTGAAAGTATACAGGCGGCACTTAGTGCACGAAGTGGGTCATCTATTTTGGAGAACCCTCCAGACCCCTACTACCTTTTAATTAGGGAATTTCA
AGATGTGGTATGTCATAATCTACCGTCTGTATTACCTCCCAATAGGGGCGTACGTCATGAAATTAACTTGGTTCCTGGAACCAAATACTGCGGTAAAAGG
CTGTGGCCTTTTCCAAAGGAGCAATATGACGTCATTGAAGAGTTTCCAGTACTAAGCACGCGGCGGAAATGGTGCGGGAGAGTAAGTCTCCTCATTCCAC
ACCGACATTTTGTGTAAAAAAAACTAATAGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAATGCGAACACTATATCAGCACAAACACCCATTCCT
AGAAAGGACGTTCTTCAGAACAACATGACAGGATGTACAATGTACGGTGCACTCGACCTGGTCGATGATTATTATCAACTGCTCATGCGAGCAAGTGATA
TCCCGCTTACCGCGGCTAGTACTCC