Description :
From Genome Similarity Track
Location :
Scaffold_212:40040- 41277
Transcript NameFunction/comments
Physo_125174reverse transcriptase

Sequence
1237 bases(100 bases per row)
GGCACTCTGATTGAATTCATACAGAAGCGCATCACAATTGAGCCAACCACTCAGGATCGTCGTATCCTTTCCACTTGATCAGGTACTAGCGGAATCTCTT
GGAAGTACGAGTGCGCTTGGCCCACCGGAGGTCCAGAATCTTTTCCACTTCGTACTCATCATTCTGTTCGTCCGGCTCCCAGCTGTCCTCGGGCAGCAGG
GCTGCATCGAAATCGTCGTCATCATCCAGATCGAGTTCCGCGGTAGGTAGCTTCGTAAACAGAGCGCGAGGCTTGAGGCGGCTGATGTGTACCCAGGGGT
TAACACGATATCCTGTGTCCTCCACCTTGAGTTTCACTCTGAAGTCATCGTGTACCTCTTCGATCCTGAACGGCCCATGCCACATGTGAGCCAGCTTGCG
GCTCAATCCGGTCTGGACTTTCGGGCTGTAGAGCCATACCGAATCACCCTTCTCAAATCCTGTCTTCAGCCTCTAGGACAATTCTCTCCACTTGCGTGTC
TGTTCTTCCGATCGTGTTCGCTTCGCTTGTCTCTGGAGGTCCTCGGCACAGGCTATTGCGTAGCTGTAGTCGCGCTGAAATTTCCGACGCCACTCGTACG
CAGTGCGTTCAGGCACACTGGATGGTTTCGGACCTAACATCGCCGTCACCGTGCCTTGCGCATCCCAACCGTGTACCAGATAGAATGGAGTGCCCAATCG
GGTCGCGTCGAACGAGGTGTTGAGGGCGAACATCAGTCGCTCAGCGTGATCATCCCAGTCAGACTGGTCAGACTCAGCGATGTAAGCGCGGACGCTCCGG
ATGACGGTCTGCACCGAACGTTCCTGTTGGCCGTTCGCTTGAGGACGATATGCCAACGTGGCGCGCTGACGACTGCCGAGTAGCTCCCGAAACCGAGTGA
AGACCTCACTCATGAAACGTGGGTCTTGATCGTGTCTGATCATCGACGACTCACCGAAATTCCGGAAGACTCGCTCTTCATAGGCATCTGCTACATCATG
TGCCGTAGTAGACGACATGGGTTTACACATCACGTAATCAGAGAATGAATCCTGAAAAAGCAGTAGGAAGGTGTTCCCTCGTGCCGACTTGGGCATGTGC
GTCACAAAATCCATCAACACAACTTCAAACGGGCGCCTGGGCTCGATGTTACCAGGTGACGGTCCAGGGTTGGGAGGTCGCCCCTTTCCATTTGCACAGT
CAACGCACTCCTTCACAAAACGTTCCACGTCGGCATA