Description :
From Genome Similarity Track
Location :
contig_120:40036- 41906
Transcript NameFunction/comments
g13409.t1hypothetical protein

Sequence
1870 bases(100 bases per row)
AGACTTAATTGCTTGAGACGGTCGCCTCTAAACGGAGGGGCCCTGGAGCGCGCCGCCCGCGCTTTGCCTACCTGTGGTGCTCCGTATCTCGCCAGGATAC
AAGTCTCTGCTGCAACGGCAACTTGTTGCAAGCAGGGACATGAGCTCTCGAACTTCGAGTCGAAGCTCTAATCCCTGGCTCTGATGCAGCCAAGTTGGCC
CGACACAGGACGCTTGCACGGACACTTGAGCCTAGTATGGTTACCTAAAAAAGAGCGTCAAACGCATCGGCTCTGTTCGAGCGCCGTTCTCACAAGGCAA
ATCTGCAGCGGTGGACGAGTGCGAGCCGCATTAACTCGCTCACTTTGGAAATTTTCTTCTCCTAGAGAAGCCCAGTAAGCAGCGCCGTCTTCCTTCGTCT
CGTTCGTTCCACGATGTCGGCCGCCAACGGCAAGACTGCCTTCTTCACGATGGAGGACGCCAAGGCGTCCTTCAACCTCTTCTGCTGCGTGTGCGGTATC
GGTTCGCTGGCCATGCCTTCCAACTACGCTCGCGCCGGCCCGTTGTATGCGTCTATCGCGCTGGCCTTCATGATCTTCGCCAACACGTACGCTACGCTCA
AGCTCTCCAAGGTGATGCTGGTGGCGCCGTCGTCCGTCAAGACGTACGGTGACCTAGGCGAGTGGGCCCTGGGCAAGTGGGGCCGCTTCTTCACGGTCGT
CTCTCAGATGGCGTCTGTCTGCTGGTGCCGATCGCCTTCCTGGTGCTGGGCAGCACTCTGCTGACGTGCTGTTCCCGGATTCGTTCAGCCAGATCTTCTG
GATCATCTTCATGGCGCTCATGGTCATCCCAGTTTGTCTAATCCCGACGCTGAAGGAGAGCGCAGGCATGGCGTTCGCCGGTTGCATGGGCACGGTCATC
GCCGACATCATCGCCGTGTCGTGTGTGCAGTGGAACATGCGCGGCCACGGTTCGATCCCGTCGCCAGACGTGACGCTGCACCAAGTGCTGACGTGCTCGG
TAACCTTGCTTTGGCGTACGGTGCTGCCATTGTCGTGCCCGATCTGCAGCGTGAGCACTCGCAGCCGCAGCGCATGCCGCGTGTGGTGGTGATCACCATT
CTGTTCATCTCGGCCTTCTTCATCGCTGTTGCTCTGGCTGGTTACACGGCCGGTGGCTGCCAGCTTTCGGGCAACATCCTGTACTCGATCGTGAGCACGT
CAGACCCGCTTGGCCTGGCGCCTTTGGGCTTCAGTGCCGACCGCGGTGCTGTGGTGATGTCGTACCTGTTCATGCAGGTGCACATCTCGATCGCTTTCTC
GACGCTCATGATGCCGCCGTTCTACATGGCGGAGCGCCTCATTCTGGGTATGCACAAGGGCCCCGAGATCGTGCGCTTCAACGGTGAGGCGGACCAGGCG
AACGTGGACCTTGACCTGGAGATCCAGGAGAAGCGCTCGTACATCCAGAGCTCGACGCCCATGGACACGGCCAACCGCCAGGTGTCTGCTTCGAGCTTGG
TCGAGAAGTCGGAGGGCCGTATGTCGCACCTGCGCGTGGCGCTCGAGTTCGGCGATGAGATCACGGCGGAGCAGCTGCACGAGCCGTACCGCAACAACCC
GCTGCGCTACATCGCCCTGCGCATTTGCATCATTGTGATTCTGGTGATCATCGCCGTGCTGGCGCGCAAGCGTTTCCTGGACCTGGAGGACTTCACGGGC
GCCACTGCCACACAACGAGCTGCCTGCTCATGCCGCTGATCATTTACCTGCGCGTGTTCTGGAAGAGCATGTCAATCCTGGACAAGGGTGCATCGATGCT
GGTGATCCTAGTATGCGCGGTCACTGGTTGCTACGTGATGATCCACGCCGGTAAGCAGCTCTTCACGCCA