Description :
From Genome Similarity Track
Location :
Scaffold_25:400324- 407472
Transcript NameFunction/comments
Phyra_77600microtubule-associated protein, putative

Sequence
7148 bases(100 bases per row)
ACATGGGCAACGCGCTGCTGGTCGCGTCCGTCAAGGACCGCCAGGCGGTGGCACTGGCCGATGCCATCCTCCCCTTTGACAACCTGCGGCTGCGCGAGAT
CGAGGCGTTCTGGCGCGCGTTCTACGACTCGGCGACGAGCTTCGCGCTGTCCAGGAGCCAATTGCGCTCCATCTGCTGCCGCGCAGTGGCCACAGGCGTC
TCGAGTTTGCAGGGATCGAACTCTCGCATCGCCGAGTATGCTGACGCTGCCTTTGAACTATTTGCAGATCCTTTTATGCAGAGAAGGTGGCAGCCAGGGG
CTAGAGGGATGCACAGCCAGCAATTTTCAGCTTCCAGCGATAGTTTGGCGGCAATTGACGCCCTCGAATTCCTTTCGGCTATTGCGTTCATTGCTGCAAT
TCCGCTGGATGAGAAGATCGATTTGCTGTTTGATTCGTGGGATATGTCGGAGGACGGAGCGCTGGACTTAGATGAGTTCACGATCTCATTGAAGTCGACG
CTGTCGGGACTGGTCAAGATCCTTCAGCCGGTTGGCCCTAATCTTGCAGTCAGAGCGGCGAACTCGGATACGGTGGTCAATGAAGAGGAGATTGTGATGC
TGGCTGAATCGACTTTCAGAGAGATCACTACCTGTGGAGTCTCGTTGTCGAAGGAGAAGTTGCCAGCGCAGGAGACTGCCACAATCACGTGTGAGCAATT
TCGGGAATTTTGTGCTAAGAACAAGCGGGCAAAGGAACTTTTCGACTTGTTTGATGTTGCAGATGCTAGCCCGGAGAAACGTGGGATAGAAGCTGGAGAC
CGGGAGGATTCAATGGAGAGTACTGAAATTACGCTAGTGGCCAAGCTTGAAAAGCACTCAGTGTCGTCGGACTCATCAATAGTCGTGGATACACCGATGG
ATGTTATGCTTGATGACGTCGGTGATATGTTTCTAGCAGTAAAGCCGTGGATAGGAGCAATTGTACCCCCAAGCAAGGTCCCCCCGATTTCTAGAGGAGC
CCCACTGATCTCAGTCCAGCTAGACTGGGTATTTGGATACAGCGCGCAAGACTGCAAAAACAACGTGCGCTTTGCTTCAACAACGGCCGGTGGCAGAGCT
GGACGCTCCGAAGAGATTGTATACCCAGCTGCAGCAACATGCGTTGTGCTCAACACAAAATCCATGACTCAGCGTCACCATCTAGCTCATACAGACGATG
TGTTGAGTTTATGTCTGCATCCCCGCCTTCCCTTGGCTGCAAGTGGTGAAATCGGCAAGCAACCTAAGATTATTGTGTGGGATTTAGACACAATGGAGAC
CCAATGCATTTTGCAAGGGTTTCACAAGCGCGGTATCTTACAATTAGCCTTCCTGGCGCCTGAATTGCTGGTATCAATCGGTGGAGACGATGATCACAGC
ATTGCAATCTACGAGTCATCCAGCAATTGGAACTCTGCAGTATTGAAAATTTCGGTGAGAGGTAACAAAGCGGTCCCGTTCCACCTCACTACAAACCCGA
GGACACCTAACGAGTTTGTTACGTGTGGTCAAAAGTACATCGAGTACTGGTCACTTGAAGGAAAAGAACTTGTGTCGAAGAAGGGTTTGCTGGGGAAAAA
AGGATCTCTGCAACCGTTTCCCGTGGCTCAGTATCTCGAAAATTCTGAACAGGCAGTAGTTGTCGGAACAAGTGATGGCTTTTTGTATCTCTTCCTTGCT
CGGCAATTGACATCCGTCATTAAGGCACACGAAGGAGCAGTCACTGCCTTATTTTACTCATCTGGGCTTTTGGTTTCTGGAGGACGAGATGGTCAAATCG
CTCAATGGGATGATAAGCTCAAACAAGTAGGCAACGCTTTCCAGATCCAAGATTTGCTTGAATCAACTTCACTGTCTGAGCGCAAGGGAATTCGAAGTTG
TTGTTATTCGCCTGATAGACGAACTATCGTCGTTGGGACACTAGCGTCAGAGATCTATGAACTGGATGCTAAGACGGGCCAAAATACTCACTCGGAGGCA
CTCACTAAAGGACACTTTCAAGGCGAACTGTGGGGATTGGATATTCACCCCACAAAGCAGCAGTGTTGTACCATTGGAGATGACCAAACGCTTCGCATTT
GGGACTTAGCAATGCAGCATGAGTTGGGATTCTTAGAGTTACCGATTCCAGGACGAGCTTGCGCTTACTCTAGCGATGGCAAATTAATCGCAGTCGGTCT
TGGCACGGAGGAATCTGGCAAGACTGGAAATCCGTCTCGGGCAAAGACCTCATCAGCTAGTTCTAAACGACGGCAGCCTAACGGTGGCTTCGTGGTGTAC
AGTGCGATGGATTTAACCTGTGCAAAGGAGCCTTGTTATGAAGCAAAACGTTGGGTGAGCGATATAAAGTTCTCCCCAGACAACAGAACGCTAGCAGTCG
CAAGCCACGATTCCAAAATCTATCTGTACAATGTTCTGAAAGGTTTCTCAAGAACTCACGTTTTCAGTAAACACTCGAGCTATATCACACATTTGGACTT
CTCACTGGACGGGAACTACTTACAGAGCACCTCAGGCGGATACGAGCTTTTATTCACCGAAGTTAAGTCTGGCAAACACGTCACAAGTGCCACAACATTT
CGGGACGAATTATGGCACACTATGACCTGCACGCTGGGCTGGTCAGTGCAGGGAATCTGGGAAGCAGAAAGCGACGGCACAGACGTAAATGCCGTTGATC
GATCTAACAACGGAAAGCTGTTGGCAACAGGCGACGATTTCGGAAAGGTGAAGGTCTTCCAGTATCCTTGTGCCTCGGAAAAAGCCTCATTCCTCGAGCT
GCGTGGGCATGCTTCTCACGTCACGAACGTTAGGTGGTCGCCTGGTGACAACTACATAGTGTCTGTAGGTGGAAATGACAGGTGCCTATTTGTCTGGAAA
CATGACCAGCAGCCCACAATGGAAGACGCCAATCACAAGCGCAACACTACCAAAAGTGAAACTACCAGTTTCGGAATCGACTTACTCAGTACGAGAGCTG
AAGACCCTTTGGAGGTCGTGGCTACGAGCGATGATATTGGAGATGAATTTATGGCGGTACGACCATGGCTCGGGGCCGTTGTGGCGCCTTCAAAGGCTGC
TTCGCTGAAAGTGGACAACACGTCTCCGAACTCAAGGTTGGAATTGGAGCGAGTTCACGGCTATCAAGCTCAAACTGCTTCAAACAATGCTCGATATGAT
TCCAACGGCAAGGTTGTATATCATACTGCCGCGCTTGGTGTTGTGTTCGACAAAGCTGCTCAGCGTCAGGCTTTCTTTAAGAGTCACGACGATGACGTCG
TCGCATTGTGTCCTCATCCGAATGGTACAACCTTTGCTACGTCACAAATGGGAAAGAAGCCCAAGATATATGTCTGGGACTCAGTGAGCGGAGCAGCTGT
AGCTCCCTGTCTGGAAGGATTTCATCAGCGTTTTGTAAATGTTATTTGCTTTTCAAGCGACGGCACAAAACTCGGAAGTGTTGGTGGCGATGATGATCAT
TCCATTGCAATTTACGCTTGGCAGAGTGGTGTATTGGTATCACAATCTCGTGGAGAACGCAACAATGTGCGCGGTATGTGCTTCCATGCTGCCACGATGG
AGTGGGTGACATGTGGTGACAAACATATTCGATTCTGGACGGAGCAAGGGAAAAACTTAACTTCGAAGAAGGCAATTTTTGGGACGAAGGCGTATCAAAA
TGGAAAGGTTCCGTCCGTCTTTGACTGTGTTGTATCGTTTGGGCAAATGGTAATTGCGGGTGGGTCGAGTGGACATCTACTTGTATTTCAGAGCTCAGTT
GATTTGACAAAGGCAGTACCGGCACATGACAGCGCTGTATTGGCACTGTATTCAACAGAGAGGGAATTAATTAGTGGTGGAAAGGACTCCAAGGTCATCG
TTTGGGATGCCCAGCTAAATAAAGTGGCTACATTCGATATGAAGGAGTACACACTTCAGGGGGCCAAACTTTTGAACTCGGAGATTCGAAGTGTTTCCTC
TAACCGAGTTTCTCCTAGAGTTTTCTTAGTTGGAACTGGCGGGAGCGATCTACTTGAGCTCGATGCTGGCCGCGCTCAACCAACTTTGTCTACAATCACA
CGCGGACATTTCAAAATGGAGGTCTGGGGTCTTGCGTGCCACCCAACCAAACCTGAATACTGCACTGTCGGCGATGACCAAACTATTCGAGTGTGGTGCC
TCGCTAAGAAAATTCAGCTAAGGGTGCAGAGGCTTGAGTGCGTAGCTCGAGCCTGTGCATTAACGGGCTCAGCCGACATTGTCGCGATAGGATTCGGTGG
GCGCAATGCGGTGACTGGTCTATCAAAAGCTGCCCAAGCAAAAACAGGAGGTATTGTTTTACTGAGCTACAGTGACTTGACGAAAAAGGTGTTTGAAGAT
CGCCCTTCCAAGCAAGCTATCAGCGAGATGAAGTTCTCGCCGAGTGGTTCCGTTCTTGCCGTTGGGTCGCATGATCATAAGATCTACCTGTATCGCCTTG
ATCGGAATACCACCAAAATCACCAAAGCATCAGCTTTCGACAAGCATCAAAGCTACATAACTCACCTTGACTTCTCAGCGGATGGTCAAGTGTTACAAAG
TAATTGCGGCGCCTACGAACTTCTTTTCAGTAATGCTACCACAGGTAAGCATATCACATCTGCGAGCAGCACGAAGGATACTCAGTGGCATTCGTGGACA
TGCGTGCTTGGGTGGCCCGTGCAAGGCATTTGGCCGCCGTGTTCCGATGGCACTGATGTGAACGCAGTCGCTCGCAATTCACGCGAAGACCTACTGGTAA
CCTCGGATGATTTTGGCCTGGTCAAGCTTTATCGGTATCCATGCGTCGCTAAGAATGCGAGCTCCATAGATCATCGCGGGCACTCGTCCCATGTGACCAA
CGTCCGGTGGGCTCTTGACGATAGCTATGTGATCAGCATTGGCGGAAATGATCGCTCCGTGATGGAGTGGAGGGTCTTAGGGCAAAATGAACGGGTTCCA
GCGGCGGGATCTGAAAAGATATTGAGCTTTGTTGAGGCAGAGGAAGTCACGGATTCGTCTGCTGAATCGGAAGAGGAATCGTTTGATGAACCTGCGGGGG
ACGAGTTTATGGCAGTAAAACCTTGGGTTGGAGCGATTGTTGCACCCACGAACGCTGCCACGCCTAACTCTCGTGAGCCCGAATTGAATGTTGAGCTTGA
ATGGGTGTACGGTTATCAATCGGAACTATCACAGCAAAACCTAGCGTACAATGCGCAAGATGAAATTGTCTACCACACTGCTGCGGTGGGAATCATCTAC
GACTCTGCAAACCATCTCCAAAAACACCACGTTGGGCATAACGACGACATTATCAGTTTCGCGCTTTGTGACGCCAAACGCAACCTCATAGCAACAGGAG
AGAGGGGAAAGAAGCCTTCACTAAGGGTATGGGATGCCCACACAGGTGAATTACGATGCGAGCTGAAGGATGCTCATACTCGCGGCATTTTGTCGCTTGC
GTTCAGCAATGACTCGACAAGGCTTGTCAGCGTAGGGGCAGATGATGACCACTCACTGGCAGTTTGGAGTGATGCCAGTAATGGATCATGGACTTTAGCA
AAACTTCTGGCAACGGGTAAAGGGGATAAAGGCCTGAACCGCTTTGCCTCGTTTGGTTCCAATCTAGATACGATTATCACTGGCGGCGTGAAGCACGTGC
TGTTTTGGTCTGTCCAAGGAAAAACCATTGTCTCCAAGAAGGGCGTAGTTGGCAAGAAAGGGACTTTGCAAACGTTTCCAATGGGCTGCAACTTCGGAGG
AGACTTTGTAACAGGGACGGCAGGTGGTGAGTTGTATGTCTGGAGAGGCAATGATCTCTCAAAGACGGTGAAAGCACATGAAGGGGAAGTCCGAGCCGTG
GCCAGTACGAATTCAATTGATAACCCGGCTGGAAATTCATCAGTTCTGCTATCAGGCGGAAAAGATGGTCGAATTATCATGTGGAACCCTGCGTACCAGT
CGCTAAAGTGTTTTGATCTGGACGCAATGCACGCCGGGAGCTTTGGCAGGATCATCAATAGCGTGTTTTTAAGCTCTACTGGCACGAAACTTCTCGTCGG
TACTTGCTCCAGTGACATCATCGAGATAGATGTAGTCAGTGGGAGTGTTCTCAATGGAGGCCAGCCGCTATTCTCCGGTCACTTTGCTATGGAGCTCTGG
GGGCTTGCCGTGCATCCCTCTCAGCGAGAATTTATCACCGTTGGTGACGACCGAACGCTGCGGGTGTGGGATATGGAGGCTAAGCGGTTAATTCAGGCAC
GCGCACTACCTGCAAAAGCTCGTGCCTGTGCATACTCGCCTGATTCCGAGCTGCTAGCAGTTGGCTTTGGTGGCGACAATGGTGTACGCCAGAAGAGAGC
AGCAGCAGCCAAACAAGGGCAAACACAATCGAGAGAAGGAGGGTTTGCTGTGTTTCGATCACGTGACCTTGATACAGATAAAGTGGTGGTTGAAGACAAG
CCAGCTAAGGAATGGATCAGTGATATCAAGTTTTCGCCCTGTGGACGTATTTTGGCGCTGGGTTCTCATGACAACGCGCTTTATCTCTACTCTGTGGGCT
CCGGGGCAACAGAGTTCAAGAAACGCAAGCCATTCAGCAAGCACAACAGCTACATTACACACTTTGATTTTTCAGACGACAGCAGCTACATACAGTCGAA
TTGCGGCGCATACGAATATTTGTTTTGCGATGCAGCATCGAGTAGCCAAGTGAGTCGAGCTTCATCTCTACGTGATGTGAAGTGGGCAACTTGGACATGC
ACCTTAGGCTGGCCTGTTCAAGGTATCTGGCCTGAATGTGCCGACGGCACTGACATCAACGCTGTTTGTGCGTCTTCATCGCGTACAATTCTCGCGTCGG
GGGATGACTCCGGCAACGTGAAGTTTTTCCGGTATCCTTGCATCCCAAAAGGGGTACGTTGCCTACTATTACGAAGACTTTGCGTGCACCTAACACCTTG
TTTTGTTATTGCATCTGCAGTCAAAGTTCATTGCCTGCCGCGGCCACTCTTCGCACGTCGCTAATGTGCGCTTCAGCTTTGACGACAAGTACGTGATCTC
AGTCGGCGGAAACGACAGATCCATTTTCCAGTGGAAGCTGGCCTAGCC