Description :
From Genome Similarity Track
Location :
contig_51:400261- 401541
Transcript NameFunction/comments
g10184.t1hypothetical protein

Sequence
1280 bases(100 bases per row)
TTGCGCTTGAGCAGCATCTGCTCCTCGAGTAGTGGCAACAATCCGAGCGGCGGTTTCTGGATCAAGTCGAGACATCGCTGGTTGTCCTGAAATTCCACAG
GGGACACTGCGATGCCCTCGCGAGCGTATCGCTCCTGCTCCAGCACAAACACGTGCTTGTTGAACTGCTGCTGCAGTGTTTCATTTGTGAAATTGATGCA
CAACTGCTCGAGGCTGTTGCGCTTCATCACCTCGAACCCGAAGATATCGAGAATTCCGATGAACGGAGCCACGGATGGCGCCGTTGCGCCGCGCGACTTT
GGCGTCTTTTTGTCGGCACCGGCTGTAGGAGGGATAAGGGATGTCTGCTGTTTGGCACAGGCATTGATACGCGCGATCACATGGTGGAAAAGCTCGCCGT
ACAGATATTTGCAGAAAGCATCCATGGCATTCTTGGCCTGCTCAGGGGTGAGCTTGATCTCCAGAATACTGCCGCGACCGGTAACGGTGGTTTGTGTTAC
CATCTTGTTGGCGAACTCCGTAGCGTCGACACCCAGCAGCATCGCTACATGCTCAAGGTTCACACCAGCATCACATTCTGGGAACACAACTCTGGTTGGC
TCGTCCTCTCGACGATCATCTCCATTGCTGTTATCTTGTGTTGTCGAGCTTTCGAATTGCACGTTGCCGAGGTGAAGAATGGCTGCCAGAAGCTCGAACA
TAGGGCGCTGGAAACTGGCGCTGTCCATTCCAAGCTGCTCCAGACACCGTCGGAGCTGATCAAACTCGGTGGCATCGTCCACTCCGTCCACCTCGACACA
ATCTCCACGGGTGAGGTACGTGTAGTTCCACACGTCGTTCCGCAGCAGTAGTGGCCGATCGGAGTCTGCAGGGTCTGACGTTGTATTCGTCAATGAATCA
AGCCCCGCTAGCAACTGGTAGAAGATGTGGTAGTTGCGCTCGTTAGCTTCCGGGCGTACGAGTCTCGTCTTCTCCAGCAGAAAGTGGCGGATCGAGACCC
CGGCCATGCGGCCTTCGCTGCTGTAGTGGATCTGGATATACTTGCCGAAACGACTCGAGTTGTCATTGCGCGAAGTCTTGGCGTTGCCGAACGACTCGAG
GATTAAGTTGGAGAGCACGACGCACTCCTCGATCTGCTCGTGAACACCTGCAGCAGCAGCTGCCGCCTTTCCGGTACTAGTGCTGGCGACGTGCTTGCTC
GCTGTGGCGAGGTACTTCATGATGTACTTGGAAGCCTCCGTCTTGCCGGCACCGCTTTCTCCGCTGATGACAATCGACTG