Description :
From Genome Similarity Track
Location :
scaffold_120:40020- 41893
Transcript NameFunction/comments
g6652.t1 hypothetical protein PHYSODRAFT_261658

Sequence
1873 bases(100 bases per row)
GTCCACATGTGCCGTCGCATTATTATTGTAGCACTGTGACAGTCGCTGAGATGAGATTGGCGAAAACGCATCCCGCTCAACCGTCTCATGGAGACTTAAT
TGCTTGAGACGGTCGCCTCTAAACGGAGGGGCCCTGGAGCGCGCCGCCCGCGCTTTGCCTACCTGTGGTGCTCCGTATCTCGCCAGGATACAAGTCTCTG
CTGCAACGGCAACTTGTTGCAAGCAGGGACATGAGCTCTCGAACTTCGAGTCGAAGCTCTAATCCCTGGCTCTGATGCAGCCAAGTTGGCCCGACACAGG
ACGCTTGCACGGACACTTGAGCCTAGTATGGTTACCTAAAAAAGAGCGTCAAACGCATCGGCTCTGTTCGAGCGCCGTTCTCACAAGGCAAGTCTGCAGC
GGTGGACGAGTGCGAGCCGCATTAACTCGCTCACTTTGGAAATTTTCTTCTCCTAGAGAAGCCCAGTAAGCAGCGCCGTCTTCCTTCGTCTCGTTCGTTC
CACGATGTCGGCCGCCAACGGCAAGACTGCCTTCTTCACGATGGAGGACGCCAAGGCGTCCTTCAACCTCTTCTGCTGCGTGTGCGGTATCGGTTCGCTG
GCCATGCCTTCCAACTACGCTCGCGCCGGCCCGTTGTATGCGTCTATCGCGCTGGCCTTCATGATCTTCGCCAACACGTACGCTACGCTCAAGCTGTCCA
AGGTGATGCTGGTGGCGCCGTCGTCCGTCAAGACGTACGGTGACCTGGGCGAGTGGGCCCTGGGCAAGTGGGGCCGCTTCTTCACGGTCGTCTCTCAGAT
GGGCGTCTGTCTGCTGGTGCCGATCGCCTTCCTGGTGCTGGGCAGCACTCTGCTGGACGTGCTGTTCCCGGATTCGTTCAGCCAGATCTTCTGGATCATC
TTCATGGCGCTCATGGTCATCCCAGTTTGTCTAATCCCGACGCTGAAGGAGAGCGCAGGCATGGCGTTCGCCGGTTGCATGGGCACGGTCATCGCCGACA
TCATCGCCGTGTCGGTGTTGCAGTGGAACATGCGCGGCCACGGTTCGATCCCGTCGCCAGACGTGACGCTGCACCAAGTGCTGACGTGCTTCGGTAACCT
TGCTTTGGCGTACGGTGCTGCCATTGTCGTGCCCGATCTGCAGCGTGAGCACTCGCAGCCGCAGCGCATGCCGCGTGTGGTGGTGATCACCATTCTGTTC
ATCTCGGCCTTCTTCATCGCTGTTGCTCTGGCTGGTTACACGGCCGGTGGCTGCCAGCTTTCGGGCAACATCCTGTACTCGATCGTGAGCACGTCAGACC
CGCTTGGCCTGGCGCCTTTGGGCTTCAGTGCCGACCGCGGTGCTGTGGTGATGTCGTACCTGTTCATGCAGGTGCACATCTCGATCGCTTTCTCGACGCT
CATGATGCCGCCGTTCTACATGGCGGAGCGCCTCATTCTGGGTATGCACAAGGGCCCCGAGATCGTGCGCTTCAACGGTGAGGCGGACCAGGCGAACGTG
GACCTTGACCTGGAGATCCAGGAGAAGCGCTCGTACATCCAGAGCTCGACGCCCATGGACACGGCCAACCGCCAGGTGTCTGCTTCGAGCTTGGTCGAGA
AGTCGGAGGGCCGTATGTCGCACCTGCGCGTGGCGCTCGAGTTCGGTGAGGAGATCACGGCGGAGCAGCTGCACGAGCCGTACCGCAACAACCCGCTGCG
CTACATCGCTCTGCGCATTTGCATCATTGTGATTCTGGTGATCATCGCCGTGCTGGCGCGCAAGCGTTTCCTGGACCTGGAGGACTTCACGGGCGCCACT
GCCCCACACAACGAGCTGCCTGCTCATGCCGCTGATCATTTACCTGCGCGTGTTCTGGAAGAGCATGTCAATC