Description :
From Genome Similarity Track
Location :
Scaffold_478:4002- 7641
Sequence
3639 bases(100 bases per row)
CGCTTCATGAGATTGCATCGCCTCGAAACGGTTCTTGCTCGCACGATCATGATCAAATTTTGGCAGGAAGGTTCCACAGTTCAGATCGGCTTCATCAATC
CAGAAAGGATTACATTTATTTTCCATTATACCAGATAATGCCCATGGACCCTCCCATATCGGTTCTTTGGTCCCTAGTGCGCATCAATTATCTTATCCAC
TTCAGATTCATCTACGTCCAGATCACCCCCAACTATATTCTTGTAGTAAGGAGTTATCAAAATCGAATCCGTCCGCCTCATCAACATTGAACGATTGGTA
GGGACTTTTGGGAATGCCCAAACATGCTTCAATTTAGAAACAAGAGCTACGGGGAACAATAGGCAAGGTATACCTGCAATCTATAAACGCACCGCGTGAT
AGCCACATCTTTCAGCCACAAGAAACGGTCCATGCCACATATGGGTTAACATTTGAGTATATTACTTCTTAGCGCGATCCAGATACATCCAAACCTACGA
TCCGCGACAAACATCCAGTAAGTCGCGATCCTTATTATGAATATCGTCTCTATCTGGATTGCAATATTAAGTAGATGTTTCACCACAGCCCTTACATGCT
GATACTGGGGTCGTATGACATATCGCCATCATCTTGGGTTCCGATAACGAGGTTTGGTGCTTCTTAACGGTAGGTTTGCTTTTAAAGCTCGTTGATTTCA
ACTGAAAAACAAGTAAAAAGACGAATCCACACGGACTCCATCCTACGCGTTGTTAATTGCATAAGTTAATTGTTCTGCGTATTAATGTCAGTCCTTTTGA
TTTTCGTCCATGACATAAACCTTAATCGCTGGGGTCATTATCTGCACCATACTTCCCGCTGTACCATTAGCTTGTGGCAAATAAGCCATGGTGGCCTGCT
GTTTCCCCGCAATCCGATTAAAAGATTGGAAGGTAGTGAACACAAATACGGCTACTGATCGTGGTGCATTGCCTCGATTGCACCAAACCGTCTGGATACA
CATTCCTCATACTTCTCTGCGATCTTTTGTGCAGTCACAAAATAAGAAAAGAAAAACAACCCACAATACCAGATCTGTATTCCCTGAAAAGTATCACGAT
AAACAAGAAACATGATCGATAGCCACAACATTGAAAGGGTACATCACTAATTGTAAATTACCAGGTGATCTGCATAAAATTAAGTGGTCTTCTTTTTCTC
GTTTTTCAGTCAACACACTCTCTCGACTATCGTTGCACGCTTCTGTACAAGGTTAACCAATGGAAATTTGCCCTGATCCATTATTAGATGCAATTGCCCC
TTGGGGTCAACCCTCCAGACTTGTATGATAGTAGTGCAAGAAATCTTGCTGTAGTAGTTCTGCGAACACCAAGAAAACCGCTTCAGTACTATCCTCCGAT
TAGGCGATCGATATCGGCAAAACAATGACAGTCCACTTTGTCCTACCTCATCCAGTGCAATCAGGATGACGACCTTTGATTCTGCCATTAATAGCGTAGC
CACATCTCCTGTCAATAATATGTTTATAAATTGAATATTCATTCTCTTGACCTTGCGCTTGCTTGACATGATCGATCCGTAGTTTCTATACAGCCTCTTC
TTGTAAAATTTCGTCTGGCAACGTCTTTCCTGGTGGATCGAGTGATAGTATCCACTTTGACCGTGTGATCGGTCCGTTTTGTTTGAGCAACTAGCTTAAT
TGATTAATAGTGATCAGTTCCTGACGATTTTGACCATATACCACAACTTTCCTCATCTCTCGGTTTAGAGCGTCACCCGCTATCCTATCTGACCCCTGAT
TTCAGCTCCGCATCATAATAAGAATCACTTTATTGACCATGATATGAGTCGCTTTTTAGCTTGATGACGTACAAAATTGTAGTCCTAAGGCATTGCAGTC
GATCCCCCCTCGCATTTGACATATCATCAAATTAATCCCCACATATAACCCTTCACCCCCTGGTTTGATCAGGAAGCACATCGAATCTGAGGAGTAACCC
TATGCCCACCGCCTCATTCACATTCAGGTCAAGGATAAACTTGGAAGCACCCTCTACGATATCCAATCGGGAATTTACATATGATCGTGCTGCATGCTCC
ACGTTTCCTTTCACCCTAGCTGATCCCTAAGAACTCAATATTAGGAGGTTTTCGTCTGCTATGGCTGTAGGTTGGGGAATACTTGTCGTCTTTCTCGAAT
TTTTACGTGGGGCAATATCAGCTAACACCTCGTCCAATTTCTCTGAAGGTGTCACACTCGCAGCCAGTTTACCCAGCAGCTCCACTTTGCCCTTCTCAGA
TTGACAAAACTCCATAATTCAATCGATTAGCAACTCAGCCCATATTTGTAACCGTTTGTTGAGGTCAGAGGATTGCAATAAGCATGTCATTGGTGAATAT
CGCGTAAGGACCGTAATCCCGCGTGATACCAGCATGCAAAACTATCGAACAATCGAGGAGATATAGCACCTCTTTCTCGACTATTCCGTAATTAAATTCG
TTAGGCTTCAACGTACAATTACAACATGTTCGGCCAATACACCCTCTCATGCTCTTGGAGTAACGCAGCCGATAATACCCACCTACTGGCATATACTACG
ATCACATGCCATTCATCGAGATGGAAATGTTACAAAATTAGTGTTGTAAATATTTTAGCTTTTTATTAGCGTAAATGCAATTTCTGCCTTCTCTAATGAC
CCCTGCTCTCGGGATTGCGATCGTGCCCATCATGGAGTGCAGATCGCGATCGTGTTTCAGTCCGGGGTCAAGTTTGGAAGTATGAGCATCCCTCGTGCGG
CTAATTTTGTGGATATCTTTTTCATACAGCACAGATGCATCGATAGCGAAGTCCTCAATAAATATTCTATAGTCATTTAGACTTCCCGGAAATGTTCGCA
TCAATCTCCACGTCCGAGGAAATGGGGGTATTCACCAGCAGTTCCAAATTGTTCGTATTAGCTTCAAAACCGCCAGCAAAATTGATGTCCTAGGTATTCC
TACCGTACGACGTCCCAAATATATAAGATAAGTTGATCGACAGTATCCACTCATTGCATCCACTCAAAAACCGCCAAGACTTTTTATAGAGGGAATACCA
CGACCTGGCAGGTATCAGTATATAGTCGGTATATAATCTCCGACCCAATACCGACGGACTTGGGTCAATGTCTGGCGTCTCTTCAGTGAACGCATCGATA
TATTTTGACAGTTCAGCCATGATCGAGTAATGTCCCGCAACAAGTTTCAAATATCCGTACAGAACGTTATCGATCAAGCACTTGTAAATCTGATGAAATT
TCTTCAATTCAAAGGGCGTCCGTAACCACTCAAATAACCCTGACGGTGTGATAAATGCGAAAATCTACCTCGCTCGTTCTGTCATCTCAACGACCTAAAC
TCTACTCGCCATAGCAAGGTAGAAATACCAATTTCATTGCTTTATCCACGCCCTCCAACAATTCACTAGTCAGAGTAATAGGGTATAACCATCAATCTTG
TCAACTAATTTCACCCGCCTATGATTAATACACAGCTTTATGTCCTCGTCGTTCATCTGGGTAATTACCACAATTGGCGAAGCCATGAGAGGTGGATGAC
CGTATGATCATGGCCGATAACAATCCTTAATTAGATCAG