Description :
From Genome Similarity Track
Location :
Scaffold_3205:400- 2109
Transcript NameFunction/comments
Phyta_totarag15140hypothetical protein PHYSODRAFT_323073

Sequence
1709 bases(100 bases per row)
ACCGGCGTTGAGGACTTGATCTTTGTAGTCCTCCGCGGTGgcgtcgaggacgaagccTCTGTCGAagaacagcttcatgaaggcgacgatgtGGCGGGAC
TCGGATTTCTTCTGAGGTTGGCGGAGTCCCAGACGCGCGGTAATCGCGTGTACGATTCGTACCACGCCGCTGAAAGGTTTGTGGCTTGATTCTTCCTGCG
CTTGGGTTTTGGTTCTTGATCTGACGTATCTTGTACTTGTCCCGCTTCAGTGCTTGCTTGTATATTTGTAGGCTTCAATAGGTCAGCCTCGACGATTGTC
AGGCTGGCATCCAGCGCGTGGTTCATTGCGATAAGCTCTTCAATGATAGCGTATTGGTGACAACCCTGGCATTCCTTGCTCTCGTCTTGTTCTGGCTTGC
GTTGTTTGTCAGGCCGAGATGTCGAGGTGTTCAGCGCTGCAGACCATGCCAGCATGTTGGTACGAGCGACTCCTGCAGCGTCCAAGCACTCTTCGACGTG
CGTCACGATCGGGGCACAAGGCGACAGCGCCTTCAGCTGCGGGAAGTACTTAATCAGGTAAGCGGTGAGTACTGCGAGGACCTTGCAACTGACGTTGAAC
CTGTGTTCCTTTAGCCCCGTGTATGAGCTGTACAGCAACTGCCGGAGGCGAGCGAGTTGCTCCTGTGTCGCATGGTCAAGGTCGGACACGTCCGCCACCA
CAGGTTCGTCATCAACGTCCCAGCCGCTCATCACGCGCGCTACCTTGCGGTTCTCTTGCGGCGTGTTGAACACGTATGCAAAGGCCTTGTTAACCTTGCT
CATATCCCAGGCACCCCTGTCGAAGATCCACTgcgccgccagcttctcgtcccCGTTCGCGTGCTGAGCGCCTCTTCGTCGAAAGGAGTGCAATGTCAGG
TCTCCGGTCGTGCCCGCTGGATCCGCCACGCGCTTCAGGAGGTGGTTTACGTACGCCTGGACTCCATCATCGCCTCGCGCAGACTCTGTCGATCGATGAG
GTGGGCGCGTAGAAGCCGATGGCGCCAAGCTTGGGTCGTCGGCAATGGGAGTTGCGACAGCACTTGCGGCGGAAGCACATGGGGCCGGCGGTCGCGTACG
AGCTTGGCGTTGCCAGGGCTACGTTCAACGAGGTTGGTTGTGCCTCGAGCAACTCAAACAGCGGTGCACCCGGATCAAGGTCACCAGCTTCGGCGGGCAC
AAGCTCAGGGAGCTGGTTCAGCAGGGAGCCACATGGGGCATCCTGCGTGACCAACGCTACAGCCAACGCGTGGAGCGGACAGGTAAGGAAGTCGTTCTTG
TCAGAGACGAGTGTGAGCCCTTGCTCTTCGGCGGTCTtcacgcgcagcaggcgcaggtAGAAGACGCTGTCAGCTGACACTGACACGTGCTGTTTCTGGA
TGTACCCCAGGTCTGGCGAGCGTCCGAAACAGTGCCACATCAGGCACGCAAGCGCCGCGTCCTGGTAGTCGGCGATCACGCGAGCGTTGCTATACACATA
CTCGGTTAATGCACGTAATTCCTCCTTCGTACACGAAGGCACCTTATTAACAAGCCCCCCTTTCTCTTTTCAGACAATATTTATCTAGCGTTTTACTTTG
CTTTAGGAGCAGTAACGCAGTAGGCACCCGTAAGTGGGGATACAGATCAAACAACCAAAGTTTAACATTTCTATAATACGAAACTGCTGTGTTGCGCGCA
AGCTTACCT