Description :
From Genome Similarity Track
Location :
Scaffold_837:400- 1481
Transcript NameFunction/comments
Phypl_g11226hypothetical protein PHYSODRAFT_566145

Sequence
1081 bases(100 bases per row)
TTTGCACCGTATAAATATCCAGAAAACATCGGTCTCCCATCGAACGGAAAGGAAGATGACCGAGCTCCACACGGCGCCGTTCGAGCACATCAATATCCTG
GAGCTCCAAGCAGTGCTCGCCCCCCCAAGCACCAGCCCCAGACACCCCCCACCGCAATGATCCACCTCGAGAGCGACGTGGTAGATCCTCCCCAACGCCA
TCAACACAGCAACACGAACAGCAACACTTAGGTCTACTGCGCTGCACGAAATGCGGCCGAGCCGGACGGAAtttctccaagaagcagctcaagccgTCAA
GGGCCGCGACTAGGAAGTGTCGGGAGTGCACGGGTCAggcaccgccagcgacaCTTCACAAGCGGTCGGACGCCCGCAGGACccctccgccgccacgatC
ACCGCATCCTCTgcgagtggcagcagccaagaGTGGCAAACGCAGCCGGAGGAGCGGGCGCGGCGTGGCAAGCGTGGGGGGTCAATGAAGCGTGCGACTG
ACGCAGTGGCTCGTTTTGGAGGCCGCTCGAAGAGGCTGCACACTCCGGCTAGGCAGACTTTTGTCTTGCAGGACGTGTATCGGAGGTAGGAGCAGTAGAT
AAGCACTGATAATTATTGAATAAGGATTTTTTCACAAGAGAACTTGACGCCTGAAAGCACAAACCATTTAATACAGTATCGCTCTAGCACATGTAGGTGT
ACCAGATAGGTCAATACGAGATGGCACTTTAGTTTGACCCCCACACCGTTGCTTTGTCCAGATCGTACGGAGACCTGTCGAATTTCAGTGTATTAGGTGG
CCTTGGCGGTAGCCTCTGAGTTTACGTCACTCGCACCGCTAGTAGCATGGAATATGTGATTCTGCCGTTTGAAATGGCTGTTTGACACTACTGTTTGTCT
ATTACCCCTTTAGCAATGTACATATTTCTCGTTCGTGGTGCTTTTTTTACCAGCAGTGCCTATGTACCACTAAAACAAGGTGTTCACGATGAGCTTGTCT
AGGTAAAATACTGCTCGAAATTCATTCGGCTTAATAATGTCAATCTAAAACGTGTGGCGCGTGAGCTAGTTTGTCGAGGCG