Description :
From Genome Similarity Track
Location :
Scaffold_1013:40- 3450
Sequence
3410 bases(100 bases per row)
CCTTTACCAATCCCAACACAAACTTGGATCCGACTCCCATTCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGAAACCTCGGCACCAC
TATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGA
CTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTA
GGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTACCCTTTGTAGATCCAGGGTTGGAGAGACTTCGGATCTAGCAAATTCAT
CCACTTGGCGCAAACTAGAAACCTTGGCAACGGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATATAGCGATGT
CTTGTTCACAAATGCATAAATGCAATACCTAGAACGATCGGCTCGTACCAGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTG
GTAACATCCCTCTGTGCTTGGTTGGATCAAACCATTGGCGGATCTGGTTGTAGAAAAATTCTTCCATTGGGCACTTGCCGACGTCGTGAATCTCGCCACA
CCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTATCACAGACCAGATGTTTCCAGCATCCAAATTCAGTGTGCTTCCGG
GATCCGCACTGCGAACACCTGACTTGTGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAAT
TGTCTCCGGTCTTCGCCGTTCGGTCGTTGGACACAGTGAGACAGACTCGACGGTAATCTTCAGGGTTGGAGTCCGAACCGTCGGATCCTGATTCAGTTCC
TGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGG
CGGGGTTTCGCGCGATCCACAGCCCGCAGCACTTCGTCAAGCTCGTCTGCGTCGCGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCA
ACGTTTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAG
GTATTCCAGCGGGGATGTATCCGATCTGTGGCGAGCATGGTAGTATTGTCGTGCCACCGACACCCCTAATCCACAGTACTGGGTCTGGAAACGGCGCAGC
AAATCTGGCCACTTGTTCCTGGTGGATCTGCTCAGCTGCCGATACCAGTTCCTGGCCGGCCCCGCTAACAGATCCGCAAAGGTCAAACACTTCTCAGCAT
CCGACGCCTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATTCGA
TATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCA
TCTGGGTCGAACTCATCATGGGAGTTGTCTTCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACAGGCG
CTCGCATACCTTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAACCTGTTGCCGTCTGGTC
CACTGGCGAGACCGGATCCGTGAAGCGATTACCTTGAGCCTGATCTGACGATAATCTCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGATGGATTGT
GTCAGATCACGCGTAGGGCCTACTGGATTCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCTTCGGATCCTCGCCTGCGCTTCCAGCATGGATCTCCCGA
AGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGTGA
CGACACTGGATCCATAGTACGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCG
AAGATATCCTCTGCGTCGAACACACCAGCTACGATGTTTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTG
GTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATA
CACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCATC
TTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTCGGTTTAGGTACAATGTTGGCTTACCTGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTT
TCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGCTTTCTCTTCTAGATCCGGATC
CGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACGCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGAC
GACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGG
TGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGATCCAGCTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCT
GCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTAAGCGTCTTGGCG
AGACGTGGGGATGGGGTGGAGCAACAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGT
CTAGATCGTAGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTG
AAAGTTGAGA